Incidental Mutation 'R0468:Men1'
ID41774
Institutional Source Beutler Lab
Gene Symbol Men1
Ensembl Gene ENSMUSG00000024947
Gene Namemultiple endocrine neoplasia 1
Synonymsmenin
MMRRC Submission 038668-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0468 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6334979-6340891 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6336923 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 5 (V5E)
Ref Sequence ENSEMBL: ENSMUSP00000126655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025897] [ENSMUST00000056391] [ENSMUST00000078137] [ENSMUST00000079327] [ENSMUST00000113500] [ENSMUST00000113501] [ENSMUST00000113501] [ENSMUST00000113502] [ENSMUST00000113503] [ENSMUST00000113504] [ENSMUST00000124556] [ENSMUST00000170132] [ENSMUST00000166909] [ENSMUST00000152349] [ENSMUST00000130382] [ENSMUST00000142496]
Predicted Effect probably benign
Transcript: ENSMUST00000025897
SMART Domains Protein: ENSMUSP00000025897
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
S_TKc 16 273 2.41e-90 SMART
low complexity region 358 369 N/A INTRINSIC
low complexity region 425 444 N/A INTRINSIC
CNH 488 801 1.31e-128 SMART
Predicted Effect probably null
Transcript: ENSMUST00000056391
AA Change: V215E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000058149
Gene: ENSMUSG00000024947
AA Change: V215E

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000078137
AA Change: V215E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000077272
Gene: ENSMUSG00000024947
AA Change: V215E

DomainStartEndE-ValueType
Pfam:Menin 1 396 2.6e-241 PFAM
Pfam:Menin 392 556 1.5e-62 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000079327
AA Change: V215E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000078306
Gene: ENSMUSG00000024947
AA Change: V215E

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113500
AA Change: V215E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000109128
Gene: ENSMUSG00000024947
AA Change: V215E

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113501
SMART Domains Protein: ENSMUSP00000109129
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 183 2.6e-104 PFAM
Pfam:Menin 184 576 3.2e-213 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113501
SMART Domains Protein: ENSMUSP00000109129
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 183 2.6e-104 PFAM
Pfam:Menin 184 576 3.2e-213 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113502
AA Change: V221E

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109130
Gene: ENSMUSG00000024947
AA Change: V221E

DomainStartEndE-ValueType
Pfam:Menin 7 515 1.5e-254 PFAM
Pfam:Menin 536 615 4.9e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113503
AA Change: V220E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000109131
Gene: ENSMUSG00000024947
AA Change: V220E

DomainStartEndE-ValueType
Pfam:Menin 1 616 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113504
AA Change: V215E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000109132
Gene: ENSMUSG00000024947
AA Change: V215E

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124333
Predicted Effect probably benign
Transcript: ENSMUST00000124556
SMART Domains Protein: ENSMUSP00000121375
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 56 4e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170132
AA Change: V5E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126655
Gene: ENSMUSG00000024947
AA Change: V5E

DomainStartEndE-ValueType
Pfam:Menin 1 135 1.6e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148410
Predicted Effect probably null
Transcript: ENSMUST00000166909
SMART Domains Protein: ENSMUSP00000133085
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 62 8.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152349
SMART Domains Protein: ENSMUSP00000115741
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 57 3.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130382
SMART Domains Protein: ENSMUSP00000120123
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
S_TKc 16 233 3.4e-14 SMART
low complexity region 314 325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142496
SMART Domains Protein: ENSMUSP00000114243
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 56 4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170292
SMART Domains Protein: ENSMUSP00000128607
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 4 106 1.2e-28 PFAM
Meta Mutation Damage Score 0.7963 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes menin, a putative tumor suppressor associated with a syndrome known as multiple endocrine neoplasia type 1. In vitro studies have shown menin is localized to the nucleus, possesses two functional nuclear localization signals, and inhibits transcriptional activation by JunD, however, the function of this protein is not known. Two messages have been detected on northern blots but the larger message has not been characterized. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 11.5-13.5 with reduced size, edema, open neural tube and defects of the nervous system, heart and liver. Heterozygotes develop tumors of the pancreas, parathyroid, thyroid, adrenal and pituitary. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,193,310 H1298R possibly damaging Het
5530400C23Rik T C 6: 133,294,458 L155P probably benign Het
6820408C15Rik A T 2: 152,441,266 R283S probably benign Het
Aldh1l2 T A 10: 83,518,678 E104D probably benign Het
Anxa3 T C 5: 96,811,099 V22A probably benign Het
Bcl7b T C 5: 135,180,883 F188L probably benign Het
Brinp1 T A 4: 68,762,776 I506F probably damaging Het
Bsdc1 T C 4: 129,461,718 probably benign Het
Ccdc180 T C 4: 45,923,271 I1075T possibly damaging Het
Cep162 A G 9: 87,193,697 L1294P probably damaging Het
Cltc G A 11: 86,704,626 probably benign Het
Col11a1 T C 3: 114,217,058 probably benign Het
Col14a1 A T 15: 55,388,646 Y566F unknown Het
Dhx29 A G 13: 112,963,277 Q1148R probably benign Het
Ehbp1 A G 11: 22,169,184 probably benign Het
Ehd3 A G 17: 73,805,379 H46R probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Gm4553 C A 7: 142,165,625 C22F unknown Het
Hibadh C T 6: 52,557,770 probably benign Het
Hspg2 G A 4: 137,533,529 C1613Y probably damaging Het
Hydin G T 8: 110,413,223 C708F possibly damaging Het
Ifi208 A T 1: 173,683,481 M401L probably benign Het
Igsf8 G A 1: 172,318,796 V454M probably damaging Het
Irx4 G T 13: 73,266,720 probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn2 C T 18: 45,559,471 T38M possibly damaging Het
L3mbtl3 C T 10: 26,327,732 R400H unknown Het
Lrp6 T C 6: 134,485,661 T679A possibly damaging Het
Map9 T C 3: 82,374,203 probably null Het
Mettl14 T C 3: 123,371,412 D93G probably damaging Het
Neb G T 2: 52,211,556 R4601S probably damaging Het
Nell1 A G 7: 50,228,846 T272A probably damaging Het
Olfr1115 A T 2: 87,252,255 N106I probably benign Het
Olfr319 A T 11: 58,701,793 I31F probably damaging Het
Pclo C A 5: 14,677,288 probably benign Het
Pdia5 A G 16: 35,397,507 L502P probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxna4 C A 6: 32,215,246 C803F probably damaging Het
Pmfbp1 A G 8: 109,513,968 probably null Het
Ptgs1 A G 2: 36,249,193 Y468C probably damaging Het
Pxdn G T 12: 29,994,486 G488W probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sec31b T A 19: 44,518,508 probably benign Het
Shank3 G A 15: 89,549,275 V1333I probably benign Het
Slamf1 A G 1: 171,792,371 probably benign Het
Slc23a3 T A 1: 75,133,230 Q131L possibly damaging Het
Slc7a11 A G 3: 50,384,051 V303A probably damaging Het
Slc7a13 T A 4: 19,841,500 V449D probably benign Het
Srp68 A T 11: 116,248,764 I453K probably damaging Het
Steap3 A T 1: 120,234,300 V414D probably damaging Het
Tagln2 A G 1: 172,506,221 N131D probably benign Het
Tmem132d T C 5: 128,269,203 Y85C probably damaging Het
Vcam1 A T 3: 116,115,946 Y577* probably null Het
Vmn1r214 A G 13: 23,035,253 T306A probably benign Het
Zfyve1 A T 12: 83,555,274 probably benign Het
Zgrf1 T A 3: 127,562,041 N305K possibly damaging Het
Other mutations in Men1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Men1 APN 19 6337207 splice site probably null
IGL00160:Men1 APN 19 6337207 splice site probably null
IGL00161:Men1 APN 19 6337207 splice site probably null
IGL00229:Men1 APN 19 6337207 splice site probably null
IGL00231:Men1 APN 19 6337207 splice site probably null
IGL00232:Men1 APN 19 6337207 splice site probably null
IGL00434:Men1 APN 19 6337207 splice site probably null
IGL00467:Men1 APN 19 6337207 splice site probably null
IGL00468:Men1 APN 19 6337207 splice site probably null
IGL00470:Men1 APN 19 6337207 splice site probably null
IGL00476:Men1 APN 19 6337207 splice site probably null
IGL02305:Men1 APN 19 6340138 missense probably damaging 1.00
R0856:Men1 UTSW 19 6335858 missense probably damaging 1.00
R1384:Men1 UTSW 19 6339891 missense probably benign 0.12
R1870:Men1 UTSW 19 6337630 missense probably damaging 1.00
R1987:Men1 UTSW 19 6338837 missense probably damaging 0.99
R2321:Men1 UTSW 19 6339838 missense possibly damaging 0.92
R4538:Men1 UTSW 19 6336754 missense possibly damaging 0.89
R4763:Men1 UTSW 19 6335072 critical splice donor site probably null
R6147:Men1 UTSW 19 6337242 missense probably damaging 0.97
R7598:Men1 UTSW 19 6339705 missense probably benign 0.06
R7726:Men1 UTSW 19 6337282 critical splice donor site probably null
R7949:Men1 UTSW 19 6338293 missense possibly damaging 0.80
R8283:Men1 UTSW 19 6336818 missense probably damaging 1.00
R8290:Men1 UTSW 19 6338286 missense probably benign 0.09
RF002:Men1 UTSW 19 6340116 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGACTGCCCTTTACCACAGGCAC -3'
(R):5'- ATGAACGCCACCTCCATCTTACGG -3'

Sequencing Primer
(F):5'- CCAAACTGGACAGCTCGG -3'
(R):5'- TCAGGATGTACCACCTTGAGC -3'
Posted On2013-05-23