Mutagenetix > Incidental Mutation

Incidental Mutation 'R0468:Sec31b'

41775

Institutional Source

Beutler Lab

Gene Symbol

Sec31b

Ensembl Gene

ENSMUSG00000051984

Gene Name

Sec31 homolog B (S. cerevisiae)

Synonyms

LOC240667, Sec31l2

MMRRC Submission

038668-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R0468 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44516957-44545864 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 44518508 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041163] [ENSMUST00000063632] [ENSMUST00000111985]

AlphaFold

Q3TZ89

Predicted Effect

probably benign
Transcript: ENSMUST00000041163

SMART Domains

Protein: ENSMUSP00000042867
Gene: ENSMUSG00000036961

Domain	Start	End	E-Value	Type
WNT1	38	351	1.02e-185	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000063632

SMART Domains

Protein: ENSMUSP00000064900
Gene: ENSMUSG00000051984

Domain	Start	End	E-Value	Type
Blast:WD40	56	101	5e-18	BLAST
WD40	110	150	4.76e-6	SMART
WD40	159	197	1.53e1	SMART
WD40	200	245	1.85e0	SMART
WD40	249	289	2.15e-4	SMART
WD40	292	332	6.19e-1	SMART
low complexity region	551	561	N/A	INTRINSIC
low complexity region	822	841	N/A	INTRINSIC
low complexity region	909	929	N/A	INTRINSIC
low complexity region	1009	1018	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111985

SMART Domains

Protein: ENSMUSP00000107616
Gene: ENSMUSG00000051984

Domain	Start	End	E-Value	Type
WD40	2	40	1.53e1	SMART
WD40	43	88	1.85e0	SMART
WD40	92	132	2.15e-4	SMART
WD40	135	175	6.19e-1	SMART
Pfam:Sec16_C	394	612	1.3e-7	PFAM
low complexity region	665	684	N/A	INTRINSIC
low complexity region	752	772	N/A	INTRINSIC
low complexity region	852	861	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165758

SMART Domains

Protein: ENSMUSP00000130598
Gene: ENSMUSG00000051984

Domain	Start	End	E-Value	Type
low complexity region	17	36	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. The protein has moderate similarity to rat VAP1 protein which is an endosomal membrane-associated protein, containing a putative Ca2+/calmodulin-dependent kinase II phosphorylation site. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	A	G	12: 71,193,310	H1298R	possibly damaging	Het
5530400C23Rik	T	C	6: 133,294,458	L155P	probably benign	Het
6820408C15Rik	A	T	2: 152,441,266	R283S	probably benign	Het
Aldh1l2	T	A	10: 83,518,678	E104D	probably benign	Het
Anxa3	T	C	5: 96,811,099	V22A	probably benign	Het
Bcl7b	T	C	5: 135,180,883	F188L	probably benign	Het
Brinp1	T	A	4: 68,762,776	I506F	probably damaging	Het
Bsdc1	T	C	4: 129,461,718		probably benign	Het
Ccdc180	T	C	4: 45,923,271	I1075T	possibly damaging	Het
Cep162	A	G	9: 87,193,697	L1294P	probably damaging	Het
Cltc	G	A	11: 86,704,626		probably benign	Het
Col11a1	T	C	3: 114,217,058		probably benign	Het
Col14a1	A	T	15: 55,388,646	Y566F	unknown	Het
Dhx29	A	G	13: 112,963,277	Q1148R	probably benign	Het
Ehbp1	A	G	11: 22,169,184		probably benign	Het
Ehd3	A	G	17: 73,805,379	H46R	probably damaging	Het
Fam171a1	T	C	2: 3,225,396	V522A	probably benign	Het
Gm4553	C	A	7: 142,165,625	C22F	unknown	Het
Hibadh	C	T	6: 52,557,770		probably benign	Het
Hspg2	G	A	4: 137,533,529	C1613Y	probably damaging	Het
Hydin	G	T	8: 110,413,223	C708F	possibly damaging	Het
Ifi208	A	T	1: 173,683,481	M401L	probably benign	Het
Igsf8	G	A	1: 172,318,796	V454M	probably damaging	Het
Irx4	G	T	13: 73,266,720		probably benign	Het
Kcnh4	C	T	11: 100,746,932	G633E	probably benign	Het
Kcnn2	C	T	18: 45,559,471	T38M	possibly damaging	Het
L3mbtl3	C	T	10: 26,327,732	R400H	unknown	Het
Lrp6	T	C	6: 134,485,661	T679A	possibly damaging	Het
Map9	T	C	3: 82,374,203		probably null	Het
Men1	T	A	19: 6,336,923	V5E	probably null	Het
Mettl14	T	C	3: 123,371,412	D93G	probably damaging	Het
Neb	G	T	2: 52,211,556	R4601S	probably damaging	Het
Nell1	A	G	7: 50,228,846	T272A	probably damaging	Het
Olfr1115	A	T	2: 87,252,255	N106I	probably benign	Het
Olfr319	A	T	11: 58,701,793	I31F	probably damaging	Het
Pclo	C	A	5: 14,677,288		probably benign	Het
Pdia5	A	G	16: 35,397,507	L502P	probably damaging	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Plxna4	C	A	6: 32,215,246	C803F	probably damaging	Het
Pmfbp1	A	G	8: 109,513,968		probably null	Het
Ptgs1	A	G	2: 36,249,193	Y468C	probably damaging	Het
Pxdn	G	T	12: 29,994,486	G488W	probably damaging	Het
Safb	C	T	17: 56,606,025	R914C	probably damaging	Het
Shank3	G	A	15: 89,549,275	V1333I	probably benign	Het
Slamf1	A	G	1: 171,792,371		probably benign	Het
Slc23a3	T	A	1: 75,133,230	Q131L	possibly damaging	Het
Slc7a11	A	G	3: 50,384,051	V303A	probably damaging	Het
Slc7a13	T	A	4: 19,841,500	V449D	probably benign	Het
Srp68	A	T	11: 116,248,764	I453K	probably damaging	Het
Steap3	A	T	1: 120,234,300	V414D	probably damaging	Het
Tagln2	A	G	1: 172,506,221	N131D	probably benign	Het
Tmem132d	T	C	5: 128,269,203	Y85C	probably damaging	Het
Vcam1	A	T	3: 116,115,946	Y577*	probably null	Het
Vmn1r214	A	G	13: 23,035,253	T306A	probably benign	Het
Zfyve1	A	T	12: 83,555,274		probably benign	Het
Zgrf1	T	A	3: 127,562,041	N305K	possibly damaging	Het

Other mutations in Sec31b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01133:Sec31b	APN	19	44527041	missense	probably damaging	1.00
IGL01308:Sec31b	APN	19	44523683	missense	probably benign	0.02
IGL02404:Sec31b	APN	19	44534788	missense	probably damaging	0.99
IGL02663:Sec31b	APN	19	44534278	missense	probably damaging	1.00
IGL02728:Sec31b	APN	19	44523115	missense	probably damaging	0.96
IGL02830:Sec31b	APN	19	44531703	missense	probably damaging	1.00
IGL03141:Sec31b	APN	19	44526320	splice site	probably benign
IGL03247:Sec31b	APN	19	44518940	missense	possibly damaging	0.62
R0049:Sec31b	UTSW	19	44520408	splice site	probably benign
R0137:Sec31b	UTSW	19	44534382	missense	probably damaging	1.00
R0238:Sec31b	UTSW	19	44525469	unclassified	probably benign
R0239:Sec31b	UTSW	19	44525469	unclassified	probably benign
R0504:Sec31b	UTSW	19	44534786	missense	probably damaging	1.00
R0565:Sec31b	UTSW	19	44524553	missense	probably damaging	1.00
R0627:Sec31b	UTSW	19	44525607	missense	probably benign
R0749:Sec31b	UTSW	19	44524506	missense	probably damaging	0.96
R0815:Sec31b	UTSW	19	44518173	nonsense	probably null
R1162:Sec31b	UTSW	19	44517648	nonsense	probably null
R1398:Sec31b	UTSW	19	44523665	missense	probably benign	0.04
R1436:Sec31b	UTSW	19	44536195	missense	probably damaging	0.99
R1538:Sec31b	UTSW	19	44518586	missense	probably benign	0.42
R1599:Sec31b	UTSW	19	44523153	missense	possibly damaging	0.92
R2044:Sec31b	UTSW	19	44536156	missense	probably benign	0.07
R2135:Sec31b	UTSW	19	44534696	missense	probably damaging	0.99
R2167:Sec31b	UTSW	19	44543353	missense	possibly damaging	0.89
R2211:Sec31b	UTSW	19	44523150	missense	probably damaging	1.00
R2938:Sec31b	UTSW	19	44536179	missense	probably damaging	0.99
R3113:Sec31b	UTSW	19	44518185	nonsense	probably null
R4110:Sec31b	UTSW	19	44524529	missense	possibly damaging	0.62
R4111:Sec31b	UTSW	19	44524529	missense	possibly damaging	0.62
R4113:Sec31b	UTSW	19	44524529	missense	possibly damaging	0.62
R4158:Sec31b	UTSW	19	44525186	missense	probably benign	0.34
R4226:Sec31b	UTSW	19	44531710	missense	probably benign
R4646:Sec31b	UTSW	19	44526621	missense	probably benign	0.00
R4732:Sec31b	UTSW	19	44532677	missense	probably damaging	1.00
R4733:Sec31b	UTSW	19	44532677	missense	probably damaging	1.00
R4795:Sec31b	UTSW	19	44531746	missense	probably benign	0.00
R4877:Sec31b	UTSW	19	44535733	missense	probably damaging	1.00
R5150:Sec31b	UTSW	19	44520531	missense	probably benign	0.08
R5377:Sec31b	UTSW	19	44518637	missense	probably damaging	1.00
R5381:Sec31b	UTSW	19	44534371	missense	probably damaging	1.00
R5708:Sec31b	UTSW	19	44523144	missense	probably damaging	1.00
R6002:Sec31b	UTSW	19	44535764	missense	probably benign	0.04
R6185:Sec31b	UTSW	19	44543284	missense	possibly damaging	0.77
R6675:Sec31b	UTSW	19	44523775	missense	probably benign
R6946:Sec31b	UTSW	19	44534316	missense	probably damaging	1.00
R7139:Sec31b	UTSW	19	44518936	missense	probably benign	0.00
R7237:Sec31b	UTSW	19	44517708	missense	probably damaging	1.00
R7270:Sec31b	UTSW	19	44523043	missense	probably benign	0.00
R7340:Sec31b	UTSW	19	44528722	missense	probably benign	0.00
R7505:Sec31b	UTSW	19	44543707	missense	probably damaging	1.00
R7584:Sec31b	UTSW	19	44543323	missense	probably damaging	0.99
R7584:Sec31b	UTSW	19	44531556	splice site	probably null
R7763:Sec31b	UTSW	19	44523835	critical splice acceptor site	probably null
R7777:Sec31b	UTSW	19	44523773	nonsense	probably null
R7900:Sec31b	UTSW	19	44526230	missense	probably damaging	1.00
R7952:Sec31b	UTSW	19	44520540	missense	probably benign	0.01
R8057:Sec31b	UTSW	19	44519365	missense	probably damaging	1.00
R8197:Sec31b	UTSW	19	44524516	missense	probably benign	0.25
R8739:Sec31b	UTSW	19	44519181	missense	probably benign	0.16
R8822:Sec31b	UTSW	19	44519263	missense	probably benign	0.02
R8837:Sec31b	UTSW	19	44517667	nonsense	probably null
R8916:Sec31b	UTSW	19	44532344	missense
R9069:Sec31b	UTSW	19	44519302	missense	probably damaging	0.98
R9259:Sec31b	UTSW	19	44517416	missense	probably damaging	1.00
R9493:Sec31b	UTSW	19	44520582	missense	probably damaging	1.00
RF023:Sec31b	UTSW	19	44535787	missense	probably damaging	1.00
Z1177:Sec31b	UTSW	19	44517314	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCTCAAAGCTGTCCTTCACG -3'
(R):5'- TGAGACATTCATGCCTCCAGCACC -3'

Sequencing Primer
(F):5'- GCCCTGTGACTCAAGGTCATAC -3'
(R):5'- ACCAATTACAGCTCCGCTTAG -3'

Posted On

2013-05-23