Incidental Mutation 'R0470:Cilp2'
ID41801
Institutional Source Beutler Lab
Gene Symbol Cilp2
Ensembl Gene ENSMUSG00000044006
Gene Namecartilage intermediate layer protein 2
Synonyms1110031K21Rik, CLIP-2
MMRRC Submission 038670-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0470 (G1)
Quality Score186
Status Validated
Chromosome8
Chromosomal Location69880369-69887687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69885405 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 192 (V192E)
Ref Sequence ENSEMBL: ENSMUSP00000061544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057831] [ENSMUST00000152938] [ENSMUST00000180068]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057831
AA Change: V192E

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061544
Gene: ENSMUSG00000044006
AA Change: V192E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Mucin2_WxxW 58 143 2.5e-22 PFAM
TSP1 149 197 1.33e-9 SMART
Pfam:CarboxypepD_reg 210 288 4.5e-10 PFAM
IGc2 305 367 2.52e-9 SMART
low complexity region 472 481 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
low complexity region 693 703 N/A INTRINSIC
low complexity region 705 719 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 1041 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152456
Predicted Effect probably benign
Transcript: ENSMUST00000152938
SMART Domains Protein: ENSMUSP00000118931
Gene: ENSMUSG00000048967

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:YjeF_N 17 187 5.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180068
SMART Domains Protein: ENSMUSP00000136145
Gene: ENSMUSG00000048967

DomainStartEndE-ValueType
Pfam:YjeF_N 2 159 8.8e-24 PFAM
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik C T 18: 59,075,639 R120C probably damaging Het
Ahnak T G 19: 9,008,967 D2538E probably benign Het
Akr1c13 T A 13: 4,198,501 L235H probably damaging Het
Ank G A 15: 27,571,635 C331Y probably damaging Het
Ankrd12 T C 17: 65,986,134 E768G probably benign Het
Atm A T 9: 53,460,966 V2172E probably damaging Het
Atp10b T A 11: 43,203,039 L470Q possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Cdadc1 A T 14: 59,573,841 probably benign Het
Cfhr2 A T 1: 139,821,779 V155E probably damaging Het
Chp1 C T 2: 119,560,763 R34C probably damaging Het
Cyth1 T C 11: 118,132,248 probably benign Het
Dnah8 T A 17: 30,708,540 probably benign Het
Gja3 T C 14: 57,036,427 T163A probably damaging Het
Gsdmcl1 C T 15: 63,850,431 noncoding transcript Het
Herc6 C T 6: 57,619,452 T459M probably damaging Het
Hexb A G 13: 97,177,999 L412P probably damaging Het
Il17ra T G 6: 120,481,806 D639E probably benign Het
Kcnh5 G A 12: 75,114,414 T240I probably benign Het
Lef1 T C 3: 131,112,826 probably benign Het
Lilrb4a T A 10: 51,494,827 N282K possibly damaging Het
Mbnl2 A T 14: 120,404,650 H342L probably damaging Het
Nipal3 A G 4: 135,447,372 V356A probably damaging Het
Olfr441 C G 6: 43,116,624 A294G probably null Het
Olfr640 A T 7: 104,021,670 I216N probably damaging Het
Plekha6 G A 1: 133,272,307 R208Q probably benign Het
Prkar1b A G 5: 139,050,749 I82T probably damaging Het
Prrc1 C T 18: 57,363,397 T140M probably damaging Het
Psg22 A C 7: 18,719,664 S95R probably damaging Het
Ptk6 T C 2: 181,195,939 T396A probably benign Het
Ptov1 A G 7: 44,864,811 S9P probably damaging Het
Scin A C 12: 40,073,292 probably benign Het
Sec13 T C 6: 113,740,632 probably benign Het
Setd1a G A 7: 127,785,057 probably benign Het
Sf3a2 G A 10: 80,804,554 probably benign Het
Shmt1 T C 11: 60,792,963 Y341C possibly damaging Het
Slc27a4 T A 2: 29,804,185 L7Q probably benign Het
Slc41a2 T C 10: 83,316,222 M130V possibly damaging Het
Sorcs3 T C 19: 48,797,517 probably null Het
Tex24 C T 8: 27,344,908 R155* probably null Het
Tgfb1 T A 7: 25,687,930 probably benign Het
Tmc5 A G 7: 118,639,931 D349G possibly damaging Het
Trappc13 C T 13: 104,161,004 V131I possibly damaging Het
Trim66 A G 7: 109,457,542 probably benign Het
Tspoap1 T C 11: 87,776,162 S1027P probably damaging Het
Usp34 C T 11: 23,436,001 H2143Y possibly damaging Het
Vmn1r179 A C 7: 23,928,393 Y3S probably benign Het
Vmn1r231 G A 17: 20,890,003 Q217* probably null Het
Vmn1r62 T A 7: 5,676,067 L249* probably null Het
Vmn1r71 G C 7: 10,748,092 S223C possibly damaging Het
Vmn2r109 T C 17: 20,552,886 Q491R probably benign Het
Vwf G A 6: 125,628,428 V925M possibly damaging Het
Wisp1 A G 15: 66,917,378 I238V probably benign Het
Zbtb6 A C 2: 37,429,493 L141W probably damaging Het
Zranb1 G T 7: 132,982,771 L615F probably damaging Het
Other mutations in Cilp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Cilp2 APN 8 69882846 missense probably damaging 0.96
IGL01538:Cilp2 APN 8 69881204 missense probably benign 0.13
IGL02063:Cilp2 APN 8 69882865 missense probably damaging 1.00
IGL02582:Cilp2 APN 8 69881286 missense probably damaging 1.00
IGL02892:Cilp2 APN 8 69884320 missense probably benign 0.02
R0308:Cilp2 UTSW 8 69882993 missense probably benign 0.00
R0371:Cilp2 UTSW 8 69881606 missense probably damaging 1.00
R0413:Cilp2 UTSW 8 69882993 missense probably benign 0.00
R0414:Cilp2 UTSW 8 69882993 missense probably benign 0.00
R0838:Cilp2 UTSW 8 69881719 missense probably benign 0.04
R0842:Cilp2 UTSW 8 69883118 missense probably damaging 1.00
R1807:Cilp2 UTSW 8 69882194 missense probably damaging 1.00
R1864:Cilp2 UTSW 8 69881323 missense probably damaging 1.00
R2010:Cilp2 UTSW 8 69881694 missense probably damaging 1.00
R2104:Cilp2 UTSW 8 69882792 nonsense probably null
R2339:Cilp2 UTSW 8 69882894 missense probably benign 0.04
R4572:Cilp2 UTSW 8 69882410 missense probably damaging 1.00
R5225:Cilp2 UTSW 8 69883365 missense probably damaging 1.00
R5923:Cilp2 UTSW 8 69882875 missense probably damaging 1.00
R6113:Cilp2 UTSW 8 69882359 missense probably benign 0.00
R6958:Cilp2 UTSW 8 69882540 missense probably benign 0.01
R7108:Cilp2 UTSW 8 69881129 missense probably damaging 1.00
R7454:Cilp2 UTSW 8 69883390 missense probably damaging 1.00
R7455:Cilp2 UTSW 8 69881071 missense probably damaging 1.00
R7598:Cilp2 UTSW 8 69886032 missense probably benign 0.29
R7736:Cilp2 UTSW 8 69881421 missense probably damaging 1.00
R7781:Cilp2 UTSW 8 69882347 missense possibly damaging 0.81
R8924:Cilp2 UTSW 8 69886458 missense probably damaging 0.99
Z1088:Cilp2 UTSW 8 69885410 missense possibly damaging 0.94
Z1177:Cilp2 UTSW 8 69882808 missense probably damaging 0.99
Z1177:Cilp2 UTSW 8 69884542 missense probably damaging 1.00
Z1177:Cilp2 UTSW 8 69884546 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAGATCATGTTTGTGGAGCCC -3'
(R):5'- ACATAGTTTAGAAAGCCCGCTGACC -3'

Sequencing Primer
(F):5'- GGTGAAATAACTCTTCAGGTCTTCC -3'
(R):5'- CTGACCAAGGTGGGCAG -3'
Posted On2013-05-23