Incidental Mutation 'R0470:Tspoap1'
ID41809
Institutional Source Beutler Lab
Gene Symbol Tspoap1
Ensembl Gene ENSMUSG00000034156
Gene NameTSPO associated protein 1
SynonymsBzrap1, peripheral
MMRRC Submission 038670-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0470 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87760541-87785928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87776162 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1027 (S1027P)
Ref Sequence ENSEMBL: ENSMUSP00000098209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039627] [ENSMUST00000100644]
Predicted Effect probably benign
Transcript: ENSMUST00000039627
AA Change: S1087P

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000048063
Gene: ENSMUSG00000034156
AA Change: S1087P

DomainStartEndE-ValueType
coiled coil region 121 190 N/A INTRINSIC
coiled coil region 219 249 N/A INTRINSIC
low complexity region 301 309 N/A INTRINSIC
coiled coil region 331 519 N/A INTRINSIC
low complexity region 598 612 N/A INTRINSIC
low complexity region 625 638 N/A INTRINSIC
SH3 652 715 1.85e-11 SMART
low complexity region 733 759 N/A INTRINSIC
FN3 784 864 3.14e0 SMART
FN3 878 951 4.81e-4 SMART
FN3 975 1062 7.16e0 SMART
low complexity region 1254 1265 N/A INTRINSIC
low complexity region 1301 1313 N/A INTRINSIC
low complexity region 1387 1401 N/A INTRINSIC
low complexity region 1455 1471 N/A INTRINSIC
SH3 1619 1683 5.4e-13 SMART
low complexity region 1721 1732 N/A INTRINSIC
SH3 1758 1821 5.48e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100644
AA Change: S1027P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098209
Gene: ENSMUSG00000034156
AA Change: S1027P

DomainStartEndE-ValueType
coiled coil region 121 190 N/A INTRINSIC
low complexity region 241 249 N/A INTRINSIC
coiled coil region 271 459 N/A INTRINSIC
low complexity region 538 552 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
SH3 592 655 1.85e-11 SMART
low complexity region 673 699 N/A INTRINSIC
FN3 724 804 3.14e0 SMART
FN3 818 891 4.81e-4 SMART
FN3 915 1002 7.16e0 SMART
low complexity region 1194 1205 N/A INTRINSIC
low complexity region 1241 1253 N/A INTRINSIC
low complexity region 1327 1341 N/A INTRINSIC
low complexity region 1395 1411 N/A INTRINSIC
SH3 1559 1623 5.4e-13 SMART
low complexity region 1661 1672 N/A INTRINSIC
SH3 1698 1761 5.48e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133645
SMART Domains Protein: ENSMUSP00000117356
Gene: ENSMUSG00000034156

DomainStartEndE-ValueType
low complexity region 39 50 N/A INTRINSIC
SH3 88 151 5.48e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135957
Predicted Effect probably benign
Transcript: ENSMUST00000142329
SMART Domains Protein: ENSMUSP00000118819
Gene: ENSMUSG00000034156

DomainStartEndE-ValueType
low complexity region 72 83 N/A INTRINSIC
SH3 157 221 5.4e-13 SMART
low complexity region 259 270 N/A INTRINSIC
SH3 296 359 5.48e-14 SMART
Predicted Effect silent
Transcript: ENSMUST00000144502
SMART Domains Protein: ENSMUSP00000122665
Gene: ENSMUSG00000034156

DomainStartEndE-ValueType
low complexity region 146 157 N/A INTRINSIC
PDB:2CSQ|A 223 250 8e-8 PDB
Blast:SH3 231 251 5e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153578
Meta Mutation Damage Score 0.1273 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Homozygous double-KO with Rimbp2tm1.2Geno does not exacerbate the phenotype of the latter single KO. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik C T 18: 59,075,639 R120C probably damaging Het
Ahnak T G 19: 9,008,967 D2538E probably benign Het
Akr1c13 T A 13: 4,198,501 L235H probably damaging Het
Ank G A 15: 27,571,635 C331Y probably damaging Het
Ankrd12 T C 17: 65,986,134 E768G probably benign Het
Atm A T 9: 53,460,966 V2172E probably damaging Het
Atp10b T A 11: 43,203,039 L470Q possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Cdadc1 A T 14: 59,573,841 probably benign Het
Cfhr2 A T 1: 139,821,779 V155E probably damaging Het
Chp1 C T 2: 119,560,763 R34C probably damaging Het
Cilp2 A T 8: 69,885,405 V192E possibly damaging Het
Cyth1 T C 11: 118,132,248 probably benign Het
Dnah8 T A 17: 30,708,540 probably benign Het
Gja3 T C 14: 57,036,427 T163A probably damaging Het
Gsdmcl1 C T 15: 63,850,431 noncoding transcript Het
Herc6 C T 6: 57,619,452 T459M probably damaging Het
Hexb A G 13: 97,177,999 L412P probably damaging Het
Il17ra T G 6: 120,481,806 D639E probably benign Het
Kcnh5 G A 12: 75,114,414 T240I probably benign Het
Lef1 T C 3: 131,112,826 probably benign Het
Lilrb4a T A 10: 51,494,827 N282K possibly damaging Het
Mbnl2 A T 14: 120,404,650 H342L probably damaging Het
Nipal3 A G 4: 135,447,372 V356A probably damaging Het
Olfr441 C G 6: 43,116,624 A294G probably null Het
Olfr640 A T 7: 104,021,670 I216N probably damaging Het
Plekha6 G A 1: 133,272,307 R208Q probably benign Het
Prkar1b A G 5: 139,050,749 I82T probably damaging Het
Prrc1 C T 18: 57,363,397 T140M probably damaging Het
Psg22 A C 7: 18,719,664 S95R probably damaging Het
Ptk6 T C 2: 181,195,939 T396A probably benign Het
Ptov1 A G 7: 44,864,811 S9P probably damaging Het
Scin A C 12: 40,073,292 probably benign Het
Sec13 T C 6: 113,740,632 probably benign Het
Setd1a G A 7: 127,785,057 probably benign Het
Sf3a2 G A 10: 80,804,554 probably benign Het
Shmt1 T C 11: 60,792,963 Y341C possibly damaging Het
Slc27a4 T A 2: 29,804,185 L7Q probably benign Het
Slc41a2 T C 10: 83,316,222 M130V possibly damaging Het
Sorcs3 T C 19: 48,797,517 probably null Het
Tex24 C T 8: 27,344,908 R155* probably null Het
Tgfb1 T A 7: 25,687,930 probably benign Het
Tmc5 A G 7: 118,639,931 D349G possibly damaging Het
Trappc13 C T 13: 104,161,004 V131I possibly damaging Het
Trim66 A G 7: 109,457,542 probably benign Het
Usp34 C T 11: 23,436,001 H2143Y possibly damaging Het
Vmn1r179 A C 7: 23,928,393 Y3S probably benign Het
Vmn1r231 G A 17: 20,890,003 Q217* probably null Het
Vmn1r62 T A 7: 5,676,067 L249* probably null Het
Vmn1r71 G C 7: 10,748,092 S223C possibly damaging Het
Vmn2r109 T C 17: 20,552,886 Q491R probably benign Het
Vwf G A 6: 125,628,428 V925M possibly damaging Het
Wisp1 A G 15: 66,917,378 I238V probably benign Het
Zbtb6 A C 2: 37,429,493 L141W probably damaging Het
Zranb1 G T 7: 132,982,771 L615F probably damaging Het
Other mutations in Tspoap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Tspoap1 APN 11 87777821 splice site probably null
IGL01718:Tspoap1 APN 11 87780255 missense possibly damaging 0.90
IGL02427:Tspoap1 APN 11 87762515 missense probably benign 0.00
IGL02487:Tspoap1 APN 11 87762516 missense possibly damaging 0.90
IGL02730:Tspoap1 APN 11 87781709 missense probably damaging 0.98
IGL02979:Tspoap1 APN 11 87770521 missense probably damaging 1.00
R0384:Tspoap1 UTSW 11 87766454 missense probably damaging 1.00
R0396:Tspoap1 UTSW 11 87776346 splice site probably benign
R0637:Tspoap1 UTSW 11 87777240 splice site probably benign
R0671:Tspoap1 UTSW 11 87762809 missense probably damaging 1.00
R0960:Tspoap1 UTSW 11 87770595 splice site probably benign
R0989:Tspoap1 UTSW 11 87765823 missense probably damaging 0.99
R1396:Tspoap1 UTSW 11 87766120 missense probably damaging 1.00
R1792:Tspoap1 UTSW 11 87765881 splice site probably null
R2901:Tspoap1 UTSW 11 87777975 missense probably benign 0.00
R2902:Tspoap1 UTSW 11 87777975 missense probably benign 0.00
R3969:Tspoap1 UTSW 11 87762446 missense probably damaging 1.00
R4400:Tspoap1 UTSW 11 87775603 missense probably damaging 1.00
R4599:Tspoap1 UTSW 11 87779521 missense probably damaging 1.00
R4635:Tspoap1 UTSW 11 87777857 missense probably benign 0.25
R4731:Tspoap1 UTSW 11 87765647 missense probably benign 0.09
R4755:Tspoap1 UTSW 11 87771663 missense possibly damaging 0.77
R4780:Tspoap1 UTSW 11 87778443 missense possibly damaging 0.48
R4960:Tspoap1 UTSW 11 87766396 nonsense probably null
R5494:Tspoap1 UTSW 11 87775205 missense possibly damaging 0.47
R5687:Tspoap1 UTSW 11 87777126 missense probably damaging 1.00
R6200:Tspoap1 UTSW 11 87761703 missense possibly damaging 0.85
R6563:Tspoap1 UTSW 11 87777159 missense possibly damaging 0.87
R6816:Tspoap1 UTSW 11 87765665 missense probably benign
R6897:Tspoap1 UTSW 11 87765812 missense probably damaging 1.00
R7141:Tspoap1 UTSW 11 87774697 missense probably damaging 1.00
R7215:Tspoap1 UTSW 11 87770489 missense probably benign 0.02
R7341:Tspoap1 UTSW 11 87766379 missense probably damaging 1.00
R7360:Tspoap1 UTSW 11 87778521 missense probably benign 0.09
R7394:Tspoap1 UTSW 11 87766119 nonsense probably null
R7483:Tspoap1 UTSW 11 87761525 missense probably benign 0.00
R7617:Tspoap1 UTSW 11 87763625 missense probably benign 0.02
R7793:Tspoap1 UTSW 11 87764310 missense probably benign 0.00
R7814:Tspoap1 UTSW 11 87775524 missense probably damaging 1.00
R8371:Tspoap1 UTSW 11 87778301 missense probably benign 0.01
R8768:Tspoap1 UTSW 11 87778371 missense probably benign 0.03
Z1176:Tspoap1 UTSW 11 87776057 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- AATGCTGTCAGGATGTCAGCCG -3'
(R):5'- GCTTCCCGTTGAAGAGACAAGTACC -3'

Sequencing Primer
(F):5'- CCTCTTCCCTATAGATTATGGAGGTG -3'
(R):5'- TACCTGAGAGCAAGGGACTG -3'
Posted On2013-05-23