Incidental Mutation 'R0470:Vmn2r109'
ID 41822
Institutional Source Beutler Lab
Gene Symbol Vmn2r109
Ensembl Gene ENSMUSG00000090572
Gene Name vomeronasal 2, receptor 109
Synonyms EG627814
MMRRC Submission 038670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock # R0470 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 20540517-20564756 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20552886 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 491 (Q491R)
Ref Sequence ENSEMBL: ENSMUSP00000132641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167093]
AlphaFold K7N747
Predicted Effect probably benign
Transcript: ENSMUST00000167093
AA Change: Q491R

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: Q491R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 1.4e-35 PFAM
Pfam:NCD3G 510 563 3.1e-21 PFAM
Pfam:7tm_3 596 831 7.4e-52 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik C T 18: 59,075,639 R120C probably damaging Het
Ahnak T G 19: 9,008,967 D2538E probably benign Het
Akr1c13 T A 13: 4,198,501 L235H probably damaging Het
Ank G A 15: 27,571,635 C331Y probably damaging Het
Ankrd12 T C 17: 65,986,134 E768G probably benign Het
Atm A T 9: 53,460,966 V2172E probably damaging Het
Atp10b T A 11: 43,203,039 L470Q possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Cdadc1 A T 14: 59,573,841 probably benign Het
Cfhr2 A T 1: 139,821,779 V155E probably damaging Het
Chp1 C T 2: 119,560,763 R34C probably damaging Het
Cilp2 A T 8: 69,885,405 V192E possibly damaging Het
Cyth1 T C 11: 118,132,248 probably benign Het
Dnah8 T A 17: 30,708,540 probably benign Het
Gja3 T C 14: 57,036,427 T163A probably damaging Het
Gsdmcl1 C T 15: 63,850,431 noncoding transcript Het
Herc6 C T 6: 57,619,452 T459M probably damaging Het
Hexb A G 13: 97,177,999 L412P probably damaging Het
Il17ra T G 6: 120,481,806 D639E probably benign Het
Kcnh5 G A 12: 75,114,414 T240I probably benign Het
Lef1 T C 3: 131,112,826 probably benign Het
Lilrb4a T A 10: 51,494,827 N282K possibly damaging Het
Mbnl2 A T 14: 120,404,650 H342L probably damaging Het
Nipal3 A G 4: 135,447,372 V356A probably damaging Het
Olfr441 C G 6: 43,116,624 A294G probably null Het
Olfr640 A T 7: 104,021,670 I216N probably damaging Het
Plekha6 G A 1: 133,272,307 R208Q probably benign Het
Prkar1b A G 5: 139,050,749 I82T probably damaging Het
Prrc1 C T 18: 57,363,397 T140M probably damaging Het
Psg22 A C 7: 18,719,664 S95R probably damaging Het
Ptk6 T C 2: 181,195,939 T396A probably benign Het
Ptov1 A G 7: 44,864,811 S9P probably damaging Het
Scin A C 12: 40,073,292 probably benign Het
Sec13 T C 6: 113,740,632 probably benign Het
Setd1a G A 7: 127,785,057 probably benign Het
Sf3a2 G A 10: 80,804,554 probably benign Het
Shmt1 T C 11: 60,792,963 Y341C possibly damaging Het
Slc27a4 T A 2: 29,804,185 L7Q probably benign Het
Slc41a2 T C 10: 83,316,222 M130V possibly damaging Het
Sorcs3 T C 19: 48,797,517 probably null Het
Tex24 C T 8: 27,344,908 R155* probably null Het
Tgfb1 T A 7: 25,687,930 probably benign Het
Tmc5 A G 7: 118,639,931 D349G possibly damaging Het
Trappc13 C T 13: 104,161,004 V131I possibly damaging Het
Trim66 A G 7: 109,457,542 probably benign Het
Tspoap1 T C 11: 87,776,162 S1027P probably damaging Het
Usp34 C T 11: 23,436,001 H2143Y possibly damaging Het
Vmn1r179 A C 7: 23,928,393 Y3S probably benign Het
Vmn1r231 G A 17: 20,890,003 Q217* probably null Het
Vmn1r62 T A 7: 5,676,067 L249* probably null Het
Vmn1r71 G C 7: 10,748,092 S223C possibly damaging Het
Vwf G A 6: 125,628,428 V925M possibly damaging Het
Wisp1 A G 15: 66,917,378 I238V probably benign Het
Zbtb6 A C 2: 37,429,493 L141W probably damaging Het
Zranb1 G T 7: 132,982,771 L615F probably damaging Het
Other mutations in Vmn2r109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Vmn2r109 APN 17 20550157 missense probably damaging 1.00
IGL01383:Vmn2r109 APN 17 20541121 missense possibly damaging 0.89
IGL01469:Vmn2r109 APN 17 20541409 missense probably damaging 1.00
IGL01762:Vmn2r109 APN 17 20554392 missense probably benign
IGL01864:Vmn2r109 APN 17 20541134 missense probably benign 0.28
IGL02028:Vmn2r109 APN 17 20541080 missense probably benign 0.28
IGL02074:Vmn2r109 APN 17 20554341 missense probably benign 0.05
IGL02162:Vmn2r109 APN 17 20554160 missense probably benign 0.01
IGL02474:Vmn2r109 APN 17 20540888 missense probably benign
IGL02490:Vmn2r109 APN 17 20540984 missense possibly damaging 0.78
IGL02604:Vmn2r109 APN 17 20540701 missense probably damaging 1.00
IGL02669:Vmn2r109 APN 17 20554256 missense possibly damaging 0.64
IGL02705:Vmn2r109 APN 17 20553800 missense probably benign
IGL02745:Vmn2r109 APN 17 20541250 missense probably damaging 0.99
PIT4142001:Vmn2r109 UTSW 17 20554577 critical splice acceptor site probably null
R0389:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R0570:Vmn2r109 UTSW 17 20540675 missense probably damaging 0.99
R0855:Vmn2r109 UTSW 17 20541408 nonsense probably null
R0882:Vmn2r109 UTSW 17 20554580 splice site probably benign
R1241:Vmn2r109 UTSW 17 20555241 missense possibly damaging 0.86
R1587:Vmn2r109 UTSW 17 20540740 missense probably damaging 1.00
R1931:Vmn2r109 UTSW 17 20553810 nonsense probably null
R1957:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
R1962:Vmn2r109 UTSW 17 20553923 missense probably damaging 0.99
R2020:Vmn2r109 UTSW 17 20541186 nonsense probably null
R2073:Vmn2r109 UTSW 17 20564712 missense probably benign 0.00
R2436:Vmn2r109 UTSW 17 20554536 missense probably damaging 0.99
R3123:Vmn2r109 UTSW 17 20540986 missense probably damaging 1.00
R3839:Vmn2r109 UTSW 17 20554442 missense probably damaging 1.00
R4019:Vmn2r109 UTSW 17 20553812 missense probably benign
R4428:Vmn2r109 UTSW 17 20553024 missense probably benign
R4584:Vmn2r109 UTSW 17 20554558 nonsense probably null
R4652:Vmn2r109 UTSW 17 20541394 missense probably damaging 1.00
R4708:Vmn2r109 UTSW 17 20541343 missense probably damaging 0.97
R4823:Vmn2r109 UTSW 17 20553891 missense probably damaging 1.00
R4831:Vmn2r109 UTSW 17 20541232 missense probably benign 0.01
R4907:Vmn2r109 UTSW 17 20550086 missense probably damaging 1.00
R5011:Vmn2r109 UTSW 17 20555189 missense probably damaging 1.00
R5296:Vmn2r109 UTSW 17 20554341 missense possibly damaging 0.90
R5600:Vmn2r109 UTSW 17 20540927 missense probably damaging 1.00
R5602:Vmn2r109 UTSW 17 20540671 missense possibly damaging 0.94
R5652:Vmn2r109 UTSW 17 20540519 makesense probably null
R5702:Vmn2r109 UTSW 17 20554145 missense probably benign 0.42
R5706:Vmn2r109 UTSW 17 20554305 missense probably benign 0.16
R5714:Vmn2r109 UTSW 17 20552859 missense probably damaging 1.00
R5832:Vmn2r109 UTSW 17 20541056 missense probably benign 0.10
R6008:Vmn2r109 UTSW 17 20540719 missense probably damaging 1.00
R6334:Vmn2r109 UTSW 17 20541178 missense probably benign 0.18
R6377:Vmn2r109 UTSW 17 20564534 critical splice donor site probably null
R6738:Vmn2r109 UTSW 17 20554523 missense possibly damaging 0.52
R6857:Vmn2r109 UTSW 17 20540670 missense probably benign 0.45
R6953:Vmn2r109 UTSW 17 20540711 missense possibly damaging 0.95
R7108:Vmn2r109 UTSW 17 20564744 missense probably benign 0.03
R7229:Vmn2r109 UTSW 17 20540963 missense possibly damaging 0.80
R7238:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R7244:Vmn2r109 UTSW 17 20540683 missense possibly damaging 0.70
R7292:Vmn2r109 UTSW 17 20541438 missense probably benign 0.05
R7354:Vmn2r109 UTSW 17 20540781 missense probably damaging 1.00
R7357:Vmn2r109 UTSW 17 20541274 missense probably damaging 1.00
R7522:Vmn2r109 UTSW 17 20554403 missense probably benign 0.11
R7596:Vmn2r109 UTSW 17 20540680 missense probably damaging 0.98
R7728:Vmn2r109 UTSW 17 20552855 missense probably damaging 0.99
R7859:Vmn2r109 UTSW 17 20541174 missense probably damaging 1.00
R7871:Vmn2r109 UTSW 17 20540520 missense probably benign 0.08
R8113:Vmn2r109 UTSW 17 20554467 missense probably benign 0.01
R8153:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
R8977:Vmn2r109 UTSW 17 20554269 missense possibly damaging 0.96
Z1176:Vmn2r109 UTSW 17 20552994 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGGCAAACCAGTAGATTCTCCACG -3'
(R):5'- TCAATTCTGCTTCTTGGACACAGTGTAA -3'

Sequencing Primer
(F):5'- ccttcatacttctgaagtcataacc -3'
(R):5'- TCCTGAAGGACATTGATGAGAG -3'
Posted On 2013-05-23