Incidental Mutation 'R0470:Vmn1r231'
ID 41823
Institutional Source Beutler Lab
Gene Symbol Vmn1r231
Ensembl Gene ENSMUSG00000050933
Gene Name vomeronasal 1 receptor 231
Synonyms V1re7
MMRRC Submission 038670-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R0470 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 21109978-21110913 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 21110265 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 217 (Q217*)
Ref Sequence ENSEMBL: ENSMUSP00000056228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061278]
AlphaFold Q8R2A3
Predicted Effect probably null
Transcript: ENSMUST00000061278
AA Change: Q217*
SMART Domains Protein: ENSMUSP00000056228
Gene: ENSMUSG00000050933
AA Change: Q217*

DomainStartEndE-ValueType
Pfam:TAS2R 6 294 1.6e-13 PFAM
Pfam:V1R 36 297 1.6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232004
Meta Mutation Damage Score 0.9580 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T G 19: 8,986,331 (GRCm39) D2538E probably benign Het
Akr1c13 T A 13: 4,248,500 (GRCm39) L235H probably damaging Het
Ank G A 15: 27,571,721 (GRCm39) C331Y probably damaging Het
Ankrd12 T C 17: 66,293,129 (GRCm39) E768G probably benign Het
Atm A T 9: 53,372,266 (GRCm39) V2172E probably damaging Het
Atp10b T A 11: 43,093,866 (GRCm39) L470Q possibly damaging Het
Bcl2 G A 1: 106,640,292 (GRCm39) R107C probably damaging Het
Ccn4 A G 15: 66,789,227 (GRCm39) I238V probably benign Het
Cdadc1 A T 14: 59,811,290 (GRCm39) probably benign Het
Cfhr2 A T 1: 139,749,517 (GRCm39) V155E probably damaging Het
Chp1 C T 2: 119,391,244 (GRCm39) R34C probably damaging Het
Cilp2 A T 8: 70,338,055 (GRCm39) V192E possibly damaging Het
Cyth1 T C 11: 118,023,074 (GRCm39) probably benign Het
Dnah8 T A 17: 30,927,514 (GRCm39) probably benign Het
Gja3 T C 14: 57,273,884 (GRCm39) T163A probably damaging Het
Gsdmcl1 C T 15: 63,722,280 (GRCm39) noncoding transcript Het
Herc6 C T 6: 57,596,437 (GRCm39) T459M probably damaging Het
Hexb A G 13: 97,314,507 (GRCm39) L412P probably damaging Het
Il17ra T G 6: 120,458,767 (GRCm39) D639E probably benign Het
Kcnh5 G A 12: 75,161,188 (GRCm39) T240I probably benign Het
Lef1 T C 3: 130,906,475 (GRCm39) probably benign Het
Lilrb4a T A 10: 51,370,923 (GRCm39) N282K possibly damaging Het
Mbnl2 A T 14: 120,642,062 (GRCm39) H342L probably damaging Het
Minar2 C T 18: 59,208,711 (GRCm39) R120C probably damaging Het
Nipal3 A G 4: 135,174,683 (GRCm39) V356A probably damaging Het
Or2a54 C G 6: 43,093,558 (GRCm39) A294G probably null Het
Or51i1 A T 7: 103,670,877 (GRCm39) I216N probably damaging Het
Plekha6 G A 1: 133,200,045 (GRCm39) R208Q probably benign Het
Prkar1b A G 5: 139,036,504 (GRCm39) I82T probably damaging Het
Prrc1 C T 18: 57,496,469 (GRCm39) T140M probably damaging Het
Psg22 A C 7: 18,453,589 (GRCm39) S95R probably damaging Het
Ptk6 T C 2: 180,837,732 (GRCm39) T396A probably benign Het
Ptov1 A G 7: 44,514,235 (GRCm39) S9P probably damaging Het
Scin A C 12: 40,123,291 (GRCm39) probably benign Het
Sec13 T C 6: 113,717,593 (GRCm39) probably benign Het
Setd1a G A 7: 127,384,229 (GRCm39) probably benign Het
Sf3a2 G A 10: 80,640,388 (GRCm39) probably benign Het
Shmt1 T C 11: 60,683,789 (GRCm39) Y341C possibly damaging Het
Slc27a4 T A 2: 29,694,197 (GRCm39) L7Q probably benign Het
Slc41a2 T C 10: 83,152,086 (GRCm39) M130V possibly damaging Het
Sorcs3 T C 19: 48,785,956 (GRCm39) probably null Het
Tex24 C T 8: 27,834,936 (GRCm39) R155* probably null Het
Tgfb1 T A 7: 25,387,355 (GRCm39) probably benign Het
Tmc5 A G 7: 118,239,154 (GRCm39) D349G possibly damaging Het
Trappc13 C T 13: 104,297,512 (GRCm39) V131I possibly damaging Het
Trim66 A G 7: 109,056,749 (GRCm39) probably benign Het
Tspoap1 T C 11: 87,666,988 (GRCm39) S1027P probably damaging Het
Usp34 C T 11: 23,386,001 (GRCm39) H2143Y possibly damaging Het
Vmn1r179 A C 7: 23,627,818 (GRCm39) Y3S probably benign Het
Vmn1r62 T A 7: 5,679,066 (GRCm39) L249* probably null Het
Vmn1r71 G C 7: 10,482,019 (GRCm39) S223C possibly damaging Het
Vmn2r109 T C 17: 20,773,148 (GRCm39) Q491R probably benign Het
Vwf G A 6: 125,605,391 (GRCm39) V925M possibly damaging Het
Zbtb6 A C 2: 37,319,505 (GRCm39) L141W probably damaging Het
Zranb1 G T 7: 132,584,500 (GRCm39) L615F probably damaging Het
Other mutations in Vmn1r231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Vmn1r231 APN 17 21,110,828 (GRCm39) missense possibly damaging 0.68
IGL02124:Vmn1r231 APN 17 21,110,568 (GRCm39) missense probably damaging 1.00
IGL02151:Vmn1r231 APN 17 21,109,997 (GRCm39) missense probably benign 0.06
R0066:Vmn1r231 UTSW 17 21,109,998 (GRCm39) missense probably benign 0.27
R0066:Vmn1r231 UTSW 17 21,109,998 (GRCm39) missense probably benign 0.27
R0396:Vmn1r231 UTSW 17 21,110,661 (GRCm39) missense probably damaging 0.98
R0427:Vmn1r231 UTSW 17 21,110,490 (GRCm39) missense probably benign 0.05
R0848:Vmn1r231 UTSW 17 21,110,433 (GRCm39) missense probably damaging 1.00
R1692:Vmn1r231 UTSW 17 21,110,871 (GRCm39) missense probably benign 0.02
R1987:Vmn1r231 UTSW 17 21,110,212 (GRCm39) missense probably damaging 1.00
R1988:Vmn1r231 UTSW 17 21,110,212 (GRCm39) missense probably damaging 1.00
R2105:Vmn1r231 UTSW 17 21,110,380 (GRCm39) missense possibly damaging 0.66
R4440:Vmn1r231 UTSW 17 21,110,718 (GRCm39) missense possibly damaging 0.48
R4634:Vmn1r231 UTSW 17 21,110,660 (GRCm39) missense possibly damaging 0.46
R4646:Vmn1r231 UTSW 17 21,110,571 (GRCm39) missense probably damaging 1.00
R4678:Vmn1r231 UTSW 17 21,110,489 (GRCm39) missense possibly damaging 0.94
R4696:Vmn1r231 UTSW 17 21,110,901 (GRCm39) missense possibly damaging 0.63
R4938:Vmn1r231 UTSW 17 21,110,613 (GRCm39) missense possibly damaging 0.76
R5544:Vmn1r231 UTSW 17 21,110,840 (GRCm39) missense probably damaging 1.00
R5942:Vmn1r231 UTSW 17 21,110,417 (GRCm39) missense possibly damaging 0.83
R6053:Vmn1r231 UTSW 17 21,110,081 (GRCm39) missense probably damaging 1.00
R6692:Vmn1r231 UTSW 17 21,110,745 (GRCm39) missense possibly damaging 0.46
R6712:Vmn1r231 UTSW 17 21,109,992 (GRCm39) missense possibly damaging 0.54
R7131:Vmn1r231 UTSW 17 21,110,140 (GRCm39) missense possibly damaging 0.87
R7854:Vmn1r231 UTSW 17 21,110,894 (GRCm39) missense probably damaging 0.98
R7918:Vmn1r231 UTSW 17 21,110,236 (GRCm39) nonsense probably null
R8187:Vmn1r231 UTSW 17 21,110,893 (GRCm39) missense probably benign 0.10
R8238:Vmn1r231 UTSW 17 21,110,640 (GRCm39) missense probably benign 0.08
R8313:Vmn1r231 UTSW 17 21,110,289 (GRCm39) missense probably benign 0.02
R8525:Vmn1r231 UTSW 17 21,110,001 (GRCm39) missense probably benign 0.06
R9276:Vmn1r231 UTSW 17 21,110,560 (GRCm39) missense probably benign 0.00
RF010:Vmn1r231 UTSW 17 21,110,255 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATGTTAATCATCCACCAGCCAGC -3'
(R):5'- TGTCTTCCAGGCCATCACCATCAG -3'

Sequencing Primer
(F):5'- GCCAGCACCGCAAAAAAG -3'
(R):5'- CGTGCCTTAATGGCCTTAAAG -3'
Posted On 2013-05-23