Incidental Mutation 'R0470:Sorcs3'
ID 41829
Institutional Source Beutler Lab
Gene Symbol Sorcs3
Ensembl Gene ENSMUSG00000063434
Gene Name sortilin-related VPS10 domain containing receptor 3
Synonyms 6330404A12Rik
MMRRC Submission 038670-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R0470 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 48194464-48793944 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 48785956 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078880]
AlphaFold Q8VI51
Predicted Effect probably null
Transcript: ENSMUST00000078880
SMART Domains Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 69 91 N/A INTRINSIC
VPS10 216 818 N/A SMART
Pfam:PKD 823 901 8e-13 PFAM
transmembrane domain 1122 1141 N/A INTRINSIC
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T G 19: 8,986,331 (GRCm39) D2538E probably benign Het
Akr1c13 T A 13: 4,248,500 (GRCm39) L235H probably damaging Het
Ank G A 15: 27,571,721 (GRCm39) C331Y probably damaging Het
Ankrd12 T C 17: 66,293,129 (GRCm39) E768G probably benign Het
Atm A T 9: 53,372,266 (GRCm39) V2172E probably damaging Het
Atp10b T A 11: 43,093,866 (GRCm39) L470Q possibly damaging Het
Bcl2 G A 1: 106,640,292 (GRCm39) R107C probably damaging Het
Ccn4 A G 15: 66,789,227 (GRCm39) I238V probably benign Het
Cdadc1 A T 14: 59,811,290 (GRCm39) probably benign Het
Cfhr2 A T 1: 139,749,517 (GRCm39) V155E probably damaging Het
Chp1 C T 2: 119,391,244 (GRCm39) R34C probably damaging Het
Cilp2 A T 8: 70,338,055 (GRCm39) V192E possibly damaging Het
Cyth1 T C 11: 118,023,074 (GRCm39) probably benign Het
Dnah8 T A 17: 30,927,514 (GRCm39) probably benign Het
Gja3 T C 14: 57,273,884 (GRCm39) T163A probably damaging Het
Gsdmcl1 C T 15: 63,722,280 (GRCm39) noncoding transcript Het
Herc6 C T 6: 57,596,437 (GRCm39) T459M probably damaging Het
Hexb A G 13: 97,314,507 (GRCm39) L412P probably damaging Het
Il17ra T G 6: 120,458,767 (GRCm39) D639E probably benign Het
Kcnh5 G A 12: 75,161,188 (GRCm39) T240I probably benign Het
Lef1 T C 3: 130,906,475 (GRCm39) probably benign Het
Lilrb4a T A 10: 51,370,923 (GRCm39) N282K possibly damaging Het
Mbnl2 A T 14: 120,642,062 (GRCm39) H342L probably damaging Het
Minar2 C T 18: 59,208,711 (GRCm39) R120C probably damaging Het
Nipal3 A G 4: 135,174,683 (GRCm39) V356A probably damaging Het
Or2a54 C G 6: 43,093,558 (GRCm39) A294G probably null Het
Or51i1 A T 7: 103,670,877 (GRCm39) I216N probably damaging Het
Plekha6 G A 1: 133,200,045 (GRCm39) R208Q probably benign Het
Prkar1b A G 5: 139,036,504 (GRCm39) I82T probably damaging Het
Prrc1 C T 18: 57,496,469 (GRCm39) T140M probably damaging Het
Psg22 A C 7: 18,453,589 (GRCm39) S95R probably damaging Het
Ptk6 T C 2: 180,837,732 (GRCm39) T396A probably benign Het
Ptov1 A G 7: 44,514,235 (GRCm39) S9P probably damaging Het
Scin A C 12: 40,123,291 (GRCm39) probably benign Het
Sec13 T C 6: 113,717,593 (GRCm39) probably benign Het
Setd1a G A 7: 127,384,229 (GRCm39) probably benign Het
Sf3a2 G A 10: 80,640,388 (GRCm39) probably benign Het
Shmt1 T C 11: 60,683,789 (GRCm39) Y341C possibly damaging Het
Slc27a4 T A 2: 29,694,197 (GRCm39) L7Q probably benign Het
Slc41a2 T C 10: 83,152,086 (GRCm39) M130V possibly damaging Het
Tex24 C T 8: 27,834,936 (GRCm39) R155* probably null Het
Tgfb1 T A 7: 25,387,355 (GRCm39) probably benign Het
Tmc5 A G 7: 118,239,154 (GRCm39) D349G possibly damaging Het
Trappc13 C T 13: 104,297,512 (GRCm39) V131I possibly damaging Het
Trim66 A G 7: 109,056,749 (GRCm39) probably benign Het
Tspoap1 T C 11: 87,666,988 (GRCm39) S1027P probably damaging Het
Usp34 C T 11: 23,386,001 (GRCm39) H2143Y possibly damaging Het
Vmn1r179 A C 7: 23,627,818 (GRCm39) Y3S probably benign Het
Vmn1r231 G A 17: 21,110,265 (GRCm39) Q217* probably null Het
Vmn1r62 T A 7: 5,679,066 (GRCm39) L249* probably null Het
Vmn1r71 G C 7: 10,482,019 (GRCm39) S223C possibly damaging Het
Vmn2r109 T C 17: 20,773,148 (GRCm39) Q491R probably benign Het
Vwf G A 6: 125,605,391 (GRCm39) V925M possibly damaging Het
Zbtb6 A C 2: 37,319,505 (GRCm39) L141W probably damaging Het
Zranb1 G T 7: 132,584,500 (GRCm39) L615F probably damaging Het
Other mutations in Sorcs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sorcs3 APN 19 48,672,097 (GRCm39) critical splice donor site probably null
IGL00233:Sorcs3 APN 19 48,736,758 (GRCm39) missense probably benign 0.12
IGL00482:Sorcs3 APN 19 48,592,303 (GRCm39) missense probably benign 0.00
IGL00976:Sorcs3 APN 19 48,755,542 (GRCm39) missense probably damaging 1.00
IGL01367:Sorcs3 APN 19 48,784,814 (GRCm39) missense probably damaging 1.00
IGL01390:Sorcs3 APN 19 48,778,570 (GRCm39) missense probably damaging 1.00
IGL01548:Sorcs3 APN 19 48,782,607 (GRCm39) missense possibly damaging 0.87
IGL02162:Sorcs3 APN 19 48,523,970 (GRCm39) missense probably damaging 0.98
IGL02165:Sorcs3 APN 19 48,642,511 (GRCm39) missense probably benign 0.03
IGL02404:Sorcs3 APN 19 48,692,809 (GRCm39) splice site probably benign
IGL02830:Sorcs3 APN 19 48,711,441 (GRCm39) splice site probably null
IGL02943:Sorcs3 APN 19 48,748,377 (GRCm39) missense probably benign 0.00
R0371:Sorcs3 UTSW 19 48,592,333 (GRCm39) missense probably benign 0.00
R0456:Sorcs3 UTSW 19 48,642,483 (GRCm39) missense possibly damaging 0.94
R0466:Sorcs3 UTSW 19 48,736,758 (GRCm39) missense probably benign 0.12
R0536:Sorcs3 UTSW 19 48,791,137 (GRCm39) nonsense probably null
R0646:Sorcs3 UTSW 19 48,194,734 (GRCm39) missense probably benign 0.10
R0709:Sorcs3 UTSW 19 48,475,845 (GRCm39) missense probably benign
R0792:Sorcs3 UTSW 19 48,694,448 (GRCm39) missense possibly damaging 0.84
R0831:Sorcs3 UTSW 19 48,682,433 (GRCm39) missense probably damaging 1.00
R0836:Sorcs3 UTSW 19 48,475,833 (GRCm39) missense probably benign
R1253:Sorcs3 UTSW 19 48,195,175 (GRCm39) missense possibly damaging 0.67
R1390:Sorcs3 UTSW 19 48,682,440 (GRCm39) critical splice donor site probably null
R1522:Sorcs3 UTSW 19 48,694,448 (GRCm39) missense possibly damaging 0.84
R1570:Sorcs3 UTSW 19 48,752,620 (GRCm39) missense probably damaging 1.00
R1637:Sorcs3 UTSW 19 48,736,798 (GRCm39) critical splice donor site probably null
R1766:Sorcs3 UTSW 19 48,592,314 (GRCm39) missense possibly damaging 0.87
R1894:Sorcs3 UTSW 19 48,782,713 (GRCm39) missense probably benign 0.23
R2426:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R3789:Sorcs3 UTSW 19 48,387,150 (GRCm39) missense possibly damaging 0.46
R3818:Sorcs3 UTSW 19 48,592,343 (GRCm39) missense probably benign 0.00
R3824:Sorcs3 UTSW 19 48,711,395 (GRCm39) missense probably damaging 1.00
R3934:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R3936:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R4190:Sorcs3 UTSW 19 48,737,812 (GRCm39) missense possibly damaging 0.69
R4604:Sorcs3 UTSW 19 48,682,353 (GRCm39) missense probably benign 0.35
R4644:Sorcs3 UTSW 19 48,672,036 (GRCm39) missense probably damaging 1.00
R4774:Sorcs3 UTSW 19 48,782,602 (GRCm39) missense probably benign 0.23
R4801:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4802:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4945:Sorcs3 UTSW 19 48,752,587 (GRCm39) missense possibly damaging 0.50
R5049:Sorcs3 UTSW 19 48,748,390 (GRCm39) missense possibly damaging 0.93
R5175:Sorcs3 UTSW 19 48,748,284 (GRCm39) critical splice acceptor site probably null
R5342:Sorcs3 UTSW 19 48,784,911 (GRCm39) splice site probably null
R5848:Sorcs3 UTSW 19 48,776,950 (GRCm39) missense probably damaging 1.00
R5959:Sorcs3 UTSW 19 48,737,835 (GRCm39) missense probably damaging 1.00
R5977:Sorcs3 UTSW 19 48,784,889 (GRCm39) missense probably damaging 1.00
R6155:Sorcs3 UTSW 19 48,387,136 (GRCm39) missense possibly damaging 0.94
R6222:Sorcs3 UTSW 19 48,748,296 (GRCm39) missense possibly damaging 0.57
R6268:Sorcs3 UTSW 19 48,778,605 (GRCm39) missense probably damaging 1.00
R6416:Sorcs3 UTSW 19 48,791,198 (GRCm39) missense probably damaging 1.00
R6425:Sorcs3 UTSW 19 48,752,746 (GRCm39) critical splice donor site probably null
R6623:Sorcs3 UTSW 19 48,776,944 (GRCm39) missense probably benign 0.00
R6767:Sorcs3 UTSW 19 48,702,010 (GRCm39) missense probably damaging 0.99
R6888:Sorcs3 UTSW 19 48,682,263 (GRCm39) missense possibly damaging 0.83
R6955:Sorcs3 UTSW 19 48,737,782 (GRCm39) missense possibly damaging 0.82
R7106:Sorcs3 UTSW 19 48,694,402 (GRCm39) missense probably damaging 1.00
R7379:Sorcs3 UTSW 19 48,760,705 (GRCm39) missense possibly damaging 0.69
R7953:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8043:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8242:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8343:Sorcs3 UTSW 19 48,692,808 (GRCm39) splice site probably null
R8433:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8435:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8436:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8940:Sorcs3 UTSW 19 48,784,908 (GRCm39) critical splice donor site probably null
R8956:Sorcs3 UTSW 19 48,737,810 (GRCm39) nonsense probably null
R9051:Sorcs3 UTSW 19 48,194,809 (GRCm39) missense probably benign
R9119:Sorcs3 UTSW 19 48,642,433 (GRCm39) missense possibly damaging 0.92
R9166:Sorcs3 UTSW 19 48,784,811 (GRCm39) missense probably benign 0.01
R9328:Sorcs3 UTSW 19 48,785,950 (GRCm39) missense probably damaging 1.00
R9489:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9605:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9757:Sorcs3 UTSW 19 48,711,363 (GRCm39) missense probably damaging 1.00
X0018:Sorcs3 UTSW 19 48,760,728 (GRCm39) missense probably damaging 1.00
Z1176:Sorcs3 UTSW 19 48,634,243 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs3 UTSW 19 48,692,739 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACGCTTCTTACGGCACTTCAA -3'
(R):5'- AGCCTACAAGGTAAAGCCAACTCTGAT -3'

Sequencing Primer
(F):5'- CTTACGGCACTTCAATGAGGG -3'
(R):5'- GCCAACTCTGATTCTATAAGCATTC -3'
Posted On 2013-05-23