Incidental Mutation 'R0477:Cth'
ID 41842
Institutional Source Beutler Lab
Gene Symbol Cth
Ensembl Gene ENSMUSG00000028179
Gene Name cystathionase (cystathionine gamma-lyase)
Synonyms CSE, 0610010I13Rik
MMRRC Submission 038677-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0477 (G1)
Quality Score 131
Status Validated (trace)
Chromosome 3
Chromosomal Location 157894248-157925077 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 157905175 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 340 (L340Q)
Ref Sequence ENSEMBL: ENSMUSP00000113672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118539]
AlphaFold Q8VCN5
Predicted Effect probably damaging
Transcript: ENSMUST00000118539
AA Change: L340Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113672
Gene: ENSMUSG00000028179
AA Change: L340Q

DomainStartEndE-ValueType
Pfam:Cys_Met_Meta_PP 18 394 5.8e-157 PFAM
Pfam:Aminotran_1_2 32 235 4.3e-9 PFAM
Pfam:DegT_DnrJ_EryC1 53 246 1.9e-7 PFAM
Pfam:Aminotran_5 68 232 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198009
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic enzyme in the trans-sulfuration pathway that converts cystathione derived from methionine into cysteine. Glutathione synthesis in the liver is dependent upon the availability of cysteine. Mutations in this gene cause cystathioninuria. Alternative splicing of this gene results in three transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit hypertension associated with impaired endothelium-dependent vasorelaxation. Mice homozygous for another knock-out allele exhibit normal blood pressure but sensitivty to a low cysteine diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A T 11: 117,802,961 I85F probably benign Het
Abca8a T A 11: 110,065,225 I778L probably benign Het
Abcc5 T C 16: 20,368,569 N889S possibly damaging Het
Abcc5 T C 16: 20,398,885 N359D probably damaging Het
Adam23 A G 1: 63,557,400 probably benign Het
Adamts3 A T 5: 89,684,507 D913E probably benign Het
Ap1b1 G T 11: 5,031,787 C538F probably benign Het
Ash1l T A 3: 88,983,459 S882T probably benign Het
C9 A T 15: 6,458,183 E43D probably benign Het
Cacna2d1 T C 5: 16,194,798 probably null Het
Ces2a A G 8: 104,737,537 E267G probably damaging Het
Cfap61 A G 2: 145,939,916 D23G probably damaging Het
Col9a3 T G 2: 180,609,470 probably benign Het
Cstl1 T C 2: 148,750,988 V21A probably benign Het
Dnah8 T A 17: 30,755,080 M2813K probably damaging Het
Fam107a A T 14: 8,301,168 Y21N probably benign Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fer1l4 A G 2: 156,052,886 V21A probably benign Het
Foxc2 A T 8: 121,118,035 Y474F probably damaging Het
Hnf4g G T 3: 3,651,791 probably benign Het
Hnrnpll T C 17: 80,061,832 D54G unknown Het
Hydin A G 8: 110,418,498 Y827C probably damaging Het
Il23r A G 6: 67,452,377 V327A probably benign Het
Itih4 T A 14: 30,889,674 V118D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lamb1 A G 12: 31,326,269 D1546G possibly damaging Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Map1a T C 2: 121,302,101 S895P probably damaging Het
Mdn1 A C 4: 32,750,928 E4487A probably benign Het
Myo15 T C 11: 60,520,914 probably null Het
Nlrp4f C A 13: 65,190,906 R639L probably benign Het
Olfr1100 T A 2: 86,978,223 D191V probably damaging Het
Olfr1275 A G 2: 111,231,664 F43S probably benign Het
Pcdh9 T C 14: 93,887,678 N229S probably damaging Het
Pcnx2 A G 8: 125,761,567 V1746A probably damaging Het
Phf12 A T 11: 78,023,070 H446L possibly damaging Het
Phlpp2 A G 8: 109,895,506 probably null Het
Psmb9 A C 17: 34,182,264 V207G probably damaging Het
Ptprh C A 7: 4,597,998 D127Y possibly damaging Het
Rabep1 T G 11: 70,920,907 M535R probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scin T C 12: 40,060,516 D711G probably damaging Het
Slfn4 T C 11: 83,188,681 I6T probably benign Het
Sos1 T A 17: 80,434,934 E388V possibly damaging Het
Spag5 A C 11: 78,314,198 Q603P probably damaging Het
Supv3l1 G T 10: 62,430,585 T604N probably damaging Het
Tbx5 A G 5: 119,883,119 S397G possibly damaging Het
Tmprss5 A G 9: 49,115,165 D383G possibly damaging Het
Trim43b A G 9: 89,090,601 W167R probably damaging Het
Unc80 A T 1: 66,570,001 D1283V probably damaging Het
Upf1 A T 8: 70,334,080 V918D probably benign Het
Vmn2r100 A G 17: 19,522,514 I383M probably benign Het
Zc3h3 G T 15: 75,777,083 S733R possibly damaging Het
Zcchc2 C T 1: 106,030,270 P426S possibly damaging Het
Zkscan7 A G 9: 122,890,809 probably null Het
Other mutations in Cth
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Cth APN 3 157905167 missense probably damaging 0.99
IGL01744:Cth APN 3 157924935 missense probably benign
IGL03128:Cth APN 3 157921035 missense probably damaging 1.00
R0659:Cth UTSW 3 157920115 splice site probably benign
R1699:Cth UTSW 3 157907436 missense probably damaging 1.00
R1724:Cth UTSW 3 157913727 missense probably damaging 1.00
R1744:Cth UTSW 3 157906268 missense probably damaging 0.99
R3822:Cth UTSW 3 157918499 missense probably benign 0.27
R3937:Cth UTSW 3 157920040 missense possibly damaging 0.79
R3982:Cth UTSW 3 157913697 nonsense probably null
R4342:Cth UTSW 3 157924976 missense probably damaging 1.00
R5436:Cth UTSW 3 157894826 missense probably benign
R7466:Cth UTSW 3 157924885 missense probably benign 0.05
R8348:Cth UTSW 3 157925020 missense probably benign 0.19
R8448:Cth UTSW 3 157925020 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ACTCAGCCCAATGCAGCAGCTTAG -3'
(R):5'- AGGCTTCAAAGGCAAGCAGCTTTTC -3'

Sequencing Primer
(F):5'- CAGCAGCTTAGCAGGAGAC -3'
(R):5'- AGACAGTACATCTAATTGTCAAAAGC -3'
Posted On 2013-05-23