Incidental Mutation 'R0477:Upf1'
ID 41849
Institutional Source Beutler Lab
Gene Symbol Upf1
Ensembl Gene ENSMUSG00000058301
Gene Name UPF1 regulator of nonsense transcripts homolog (yeast)
Synonyms B430202H16Rik, PNORF-1, Rent1
MMRRC Submission 038677-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.970) question?
Stock # R0477 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 8
Chromosomal Location 70331525-70353278 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 70334080 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 918 (V918D)
Ref Sequence ENSEMBL: ENSMUSP00000148927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000140239] [ENSMUST00000165819] [ENSMUST00000207684] [ENSMUST00000215817]
AlphaFold Q9EPU0
Predicted Effect probably benign
Transcript: ENSMUST00000075666
AA Change: V929D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: V929D

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
Pfam:UPF1_Zn_bind 116 267 4.1e-78 PFAM
Pfam:ResIII 475 617 1.3e-6 PFAM
Pfam:AAA_11 476 600 4.5e-24 PFAM
Pfam:AAA_30 476 688 5.6e-13 PFAM
Pfam:AAA_19 483 559 3.8e-16 PFAM
Pfam:AAA_11 576 679 7.7e-30 PFAM
Pfam:AAA_12 686 883 3.3e-64 PFAM
low complexity region 995 1001 N/A INTRINSIC
low complexity region 1013 1028 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140239
SMART Domains Protein: ENSMUSP00000120598
Gene: ENSMUSG00000087408

DomainStartEndE-ValueType
low complexity region 49 68 N/A INTRINSIC
TLC 97 311 1.24e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165819
SMART Domains Protein: ENSMUSP00000128325
Gene: ENSMUSG00000087408

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:TGFb_propeptide 33 169 7e-16 PFAM
low complexity region 225 237 N/A INTRINSIC
TGFB 251 357 6.22e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207684
Predicted Effect probably benign
Transcript: ENSMUST00000215817
AA Change: V918D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A T 11: 117,802,961 I85F probably benign Het
Abca8a T A 11: 110,065,225 I778L probably benign Het
Abcc5 T C 16: 20,368,569 N889S possibly damaging Het
Abcc5 T C 16: 20,398,885 N359D probably damaging Het
Adam23 A G 1: 63,557,400 probably benign Het
Adamts3 A T 5: 89,684,507 D913E probably benign Het
Ap1b1 G T 11: 5,031,787 C538F probably benign Het
Ash1l T A 3: 88,983,459 S882T probably benign Het
C9 A T 15: 6,458,183 E43D probably benign Het
Cacna2d1 T C 5: 16,194,798 probably null Het
Ces2a A G 8: 104,737,537 E267G probably damaging Het
Cfap61 A G 2: 145,939,916 D23G probably damaging Het
Col9a3 T G 2: 180,609,470 probably benign Het
Cstl1 T C 2: 148,750,988 V21A probably benign Het
Cth A T 3: 157,905,175 L340Q probably damaging Het
Dnah8 T A 17: 30,755,080 M2813K probably damaging Het
Fam107a A T 14: 8,301,168 Y21N probably benign Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fer1l4 A G 2: 156,052,886 V21A probably benign Het
Foxc2 A T 8: 121,118,035 Y474F probably damaging Het
Hnf4g G T 3: 3,651,791 probably benign Het
Hnrnpll T C 17: 80,061,832 D54G unknown Het
Hydin A G 8: 110,418,498 Y827C probably damaging Het
Il23r A G 6: 67,452,377 V327A probably benign Het
Itih4 T A 14: 30,889,674 V118D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lamb1 A G 12: 31,326,269 D1546G possibly damaging Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Map1a T C 2: 121,302,101 S895P probably damaging Het
Mdn1 A C 4: 32,750,928 E4487A probably benign Het
Myo15 T C 11: 60,520,914 probably null Het
Nlrp4f C A 13: 65,190,906 R639L probably benign Het
Olfr1100 T A 2: 86,978,223 D191V probably damaging Het
Olfr1275 A G 2: 111,231,664 F43S probably benign Het
Pcdh9 T C 14: 93,887,678 N229S probably damaging Het
Pcnx2 A G 8: 125,761,567 V1746A probably damaging Het
Phf12 A T 11: 78,023,070 H446L possibly damaging Het
Phlpp2 A G 8: 109,895,506 probably null Het
Psmb9 A C 17: 34,182,264 V207G probably damaging Het
Ptprh C A 7: 4,597,998 D127Y possibly damaging Het
Rabep1 T G 11: 70,920,907 M535R probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scin T C 12: 40,060,516 D711G probably damaging Het
Slfn4 T C 11: 83,188,681 I6T probably benign Het
Sos1 T A 17: 80,434,934 E388V possibly damaging Het
Spag5 A C 11: 78,314,198 Q603P probably damaging Het
Supv3l1 G T 10: 62,430,585 T604N probably damaging Het
Tbx5 A G 5: 119,883,119 S397G possibly damaging Het
Tmprss5 A G 9: 49,115,165 D383G possibly damaging Het
Trim43b A G 9: 89,090,601 W167R probably damaging Het
Unc80 A T 1: 66,570,001 D1283V probably damaging Het
Vmn2r100 A G 17: 19,522,514 I383M probably benign Het
Zc3h3 G T 15: 75,777,083 S733R possibly damaging Het
Zcchc2 C T 1: 106,030,270 P426S possibly damaging Het
Zkscan7 A G 9: 122,890,809 probably null Het
Other mutations in Upf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Upf1 APN 8 70338284 missense probably benign
IGL01890:Upf1 APN 8 70334230 missense possibly damaging 0.94
IGL02534:Upf1 APN 8 70335652 critical splice donor site probably null
IGL03142:Upf1 APN 8 70333327 missense probably benign 0.04
IGL03151:Upf1 APN 8 70335387 missense probably damaging 0.98
Nanosphere UTSW 8 70344262 missense probably benign 0.01
Particulate UTSW 8 70337025 missense probably damaging 0.96
R0270:Upf1 UTSW 8 70335645 splice site probably benign
R0755:Upf1 UTSW 8 70334129 missense probably benign 0.01
R1018:Upf1 UTSW 8 70338906 missense possibly damaging 0.85
R1067:Upf1 UTSW 8 70338403 missense probably damaging 0.98
R1445:Upf1 UTSW 8 70341524 missense probably benign 0.00
R1458:Upf1 UTSW 8 70344254 missense probably benign 0.00
R1511:Upf1 UTSW 8 70338505 missense probably damaging 0.99
R1552:Upf1 UTSW 8 70333059 nonsense probably null
R1560:Upf1 UTSW 8 70338442 missense probably damaging 1.00
R1562:Upf1 UTSW 8 70343367 nonsense probably null
R2082:Upf1 UTSW 8 70341572 missense probably damaging 1.00
R2143:Upf1 UTSW 8 70339354 missense probably null 1.00
R2423:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R2425:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3031:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3032:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3123:Upf1 UTSW 8 70337483 splice site probably benign
R3508:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3747:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3748:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3750:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3754:Upf1 UTSW 8 70339814 missense probably benign 0.30
R3964:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3965:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R4152:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R4505:Upf1 UTSW 8 70337566 missense probably damaging 1.00
R4506:Upf1 UTSW 8 70337566 missense probably damaging 1.00
R4838:Upf1 UTSW 8 70339368 missense probably benign 0.03
R5001:Upf1 UTSW 8 70334700 missense probably damaging 1.00
R5715:Upf1 UTSW 8 70352978 missense probably damaging 0.96
R5748:Upf1 UTSW 8 70338517 missense probably damaging 1.00
R5856:Upf1 UTSW 8 70334762 critical splice acceptor site probably null
R5930:Upf1 UTSW 8 70344262 missense probably benign 0.01
R6010:Upf1 UTSW 8 70337025 missense probably damaging 0.96
R6056:Upf1 UTSW 8 70333037 missense probably damaging 0.98
R6870:Upf1 UTSW 8 70341561 missense probably benign 0.11
R7205:Upf1 UTSW 8 70340045 missense possibly damaging 0.94
R7385:Upf1 UTSW 8 70340618 missense probably damaging 1.00
R7464:Upf1 UTSW 8 70333423 missense probably benign
R7759:Upf1 UTSW 8 70334080 missense probably benign
R7783:Upf1 UTSW 8 70352858 missense probably benign 0.11
R8079:Upf1 UTSW 8 70338884 critical splice donor site probably null
R8192:Upf1 UTSW 8 70340644 missense probably benign 0.03
R8544:Upf1 UTSW 8 70337052 missense probably damaging 1.00
R8738:Upf1 UTSW 8 70333322 missense probably benign 0.01
R8738:Upf1 UTSW 8 70333323 missense probably benign 0.06
R8826:Upf1 UTSW 8 70338280 missense probably benign
R8876:Upf1 UTSW 8 70344268 missense possibly damaging 0.92
R8906:Upf1 UTSW 8 70334165 nonsense probably null
R8911:Upf1 UTSW 8 70338437 missense possibly damaging 0.53
R9163:Upf1 UTSW 8 70340024 missense probably benign
R9425:Upf1 UTSW 8 70339353 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GAAGCTACTGGACAAGTTCCAGACG -3'
(R):5'- TTTAGAGAGCTGCGAATCACACCC -3'

Sequencing Primer
(F):5'- GATAAACACATGGGTTCTGGC -3'
(R):5'- CTAACCCTAGACAGTGGAGTTCAG -3'
Posted On 2013-05-23