Mutagenetix > Incidental Mutation

Incidental Mutation 'R0477:Large1'

41850

Institutional Source

Beutler Lab

Gene Symbol

Large1

Ensembl Gene

ENSMUSG00000004383

Gene Name

LARGE xylosyl- and glucuronyltransferase 1

Synonyms

froggy, BPFD#36, fg, enr

MMRRC Submission

038677-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.654) question?

Stock #

R0477 (G1)

Quality Score

201

Status

Validated (trace)

Chromosome

Chromosomal Location

72814599-73353540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 72818082 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 689 (D689E)

Ref Sequence

ENSEMBL: ENSMUSP00000148336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]

AlphaFold

Q9Z1M7

Predicted Effect

probably damaging
Transcript: ENSMUST00000004497
AA Change: D689E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383
AA Change: D689E

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	141	387	6.2e-22	PFAM
Pfam:Glyco_transf_49	473	540	5.2e-15	PFAM
Pfam:Glyco_transf_49	535	743	1.1e-47	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000119826
AA Change: D689E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383
AA Change: D689E

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	142	386	3e-23	PFAM
Pfam:Glyco_transf_49	473	540	2.3e-11	PFAM
Pfam:Glyco_transf_49	520	743	2.7e-44	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212459
AA Change: D689E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Meta Mutation Damage Score

0.2491

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.4%
20x: 93.1%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030468B19Rik	A	T	11: 117,802,961	I85F	probably benign	Het
Abca8a	T	A	11: 110,065,225	I778L	probably benign	Het
Abcc5	T	C	16: 20,368,569	N889S	possibly damaging	Het
Abcc5	T	C	16: 20,398,885	N359D	probably damaging	Het
Adam23	A	G	1: 63,557,400		probably benign	Het
Adamts3	A	T	5: 89,684,507	D913E	probably benign	Het
Ap1b1	G	T	11: 5,031,787	C538F	probably benign	Het
Ash1l	T	A	3: 88,983,459	S882T	probably benign	Het
C9	A	T	15: 6,458,183	E43D	probably benign	Het
Cacna2d1	T	C	5: 16,194,798		probably null	Het
Ces2a	A	G	8: 104,737,537	E267G	probably damaging	Het
Cfap61	A	G	2: 145,939,916	D23G	probably damaging	Het
Col9a3	T	G	2: 180,609,470		probably benign	Het
Cstl1	T	C	2: 148,750,988	V21A	probably benign	Het
Cth	A	T	3: 157,905,175	L340Q	probably damaging	Het
Dnah8	T	A	17: 30,755,080	M2813K	probably damaging	Het
Fam107a	A	T	14: 8,301,168	Y21N	probably benign	Het
Fam184a	G	A	10: 53,655,079	T733M	probably damaging	Het
Fer1l4	A	G	2: 156,052,886	V21A	probably benign	Het
Foxc2	A	T	8: 121,118,035	Y474F	probably damaging	Het
Hnf4g	G	T	3: 3,651,791		probably benign	Het
Hnrnpll	T	C	17: 80,061,832	D54G	unknown	Het
Hydin	A	G	8: 110,418,498	Y827C	probably damaging	Het
Il23r	A	G	6: 67,452,377	V327A	probably benign	Het
Itih4	T	A	14: 30,889,674	V118D	probably damaging	Het
Kmt2d	G	A	15: 98,853,581		probably benign	Het
Lamb1	A	G	12: 31,326,269	D1546G	possibly damaging	Het
Map1a	T	C	2: 121,302,101	S895P	probably damaging	Het
Mdn1	A	C	4: 32,750,928	E4487A	probably benign	Het
Myo15	T	C	11: 60,520,914		probably null	Het
Nlrp4f	C	A	13: 65,190,906	R639L	probably benign	Het
Olfr1100	T	A	2: 86,978,223	D191V	probably damaging	Het
Olfr1275	A	G	2: 111,231,664	F43S	probably benign	Het
Pcdh9	T	C	14: 93,887,678	N229S	probably damaging	Het
Pcnx2	A	G	8: 125,761,567	V1746A	probably damaging	Het
Phf12	A	T	11: 78,023,070	H446L	possibly damaging	Het
Phlpp2	A	G	8: 109,895,506		probably null	Het
Psmb9	A	C	17: 34,182,264	V207G	probably damaging	Het
Ptprh	C	A	7: 4,597,998	D127Y	possibly damaging	Het
Rabep1	T	G	11: 70,920,907	M535R	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Scin	T	C	12: 40,060,516	D711G	probably damaging	Het
Slfn4	T	C	11: 83,188,681	I6T	probably benign	Het
Sos1	T	A	17: 80,434,934	E388V	possibly damaging	Het
Spag5	A	C	11: 78,314,198	Q603P	probably damaging	Het
Supv3l1	G	T	10: 62,430,585	T604N	probably damaging	Het
Tbx5	A	G	5: 119,883,119	S397G	possibly damaging	Het
Tmprss5	A	G	9: 49,115,165	D383G	possibly damaging	Het
Trim43b	A	G	9: 89,090,601	W167R	probably damaging	Het
Unc80	A	T	1: 66,570,001	D1283V	probably damaging	Het
Upf1	A	T	8: 70,334,080	V918D	probably benign	Het
Vmn2r100	A	G	17: 19,522,514	I383M	probably benign	Het
Zc3h3	G	T	15: 75,777,083	S733R	possibly damaging	Het
Zcchc2	C	T	1: 106,030,270	P426S	possibly damaging	Het
Zkscan7	A	G	9: 122,890,809		probably null	Het

Other mutations in Large1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Large1	APN	8	72837497	missense	probably damaging	1.00
IGL00326:Large1	APN	8	73131983	missense	probably benign
IGL00418:Large1	APN	8	72823841	critical splice acceptor site	probably null
IGL01155:Large1	APN	8	73131989	missense	probably benign	0.01
IGL01793:Large1	APN	8	72859181	splice site	probably benign
IGL01929:Large1	APN	8	72859275	missense	probably damaging	1.00
IGL02218:Large1	APN	8	72912122	missense	probably damaging	1.00
IGL02276:Large1	APN	8	72818093	missense	probably benign	0.00
IGL02329:Large1	APN	8	73048317	missense	possibly damaging	0.80
IGL02543:Large1	APN	8	73048414	missense	probably benign	0.00
IGL02887:Large1	APN	8	73132039	missense	probably benign	0.07
biggs	UTSW	8	73116419	missense	probably damaging	1.00
umber	UTSW	8	72883264	nonsense	probably null
R0179:Large1	UTSW	8	73098846	missense	probably benign	0.09
R0587:Large1	UTSW	8	72859333	missense	probably damaging	1.00
R0791:Large1	UTSW	8	73048479	splice site	probably benign
R1253:Large1	UTSW	8	73048422	missense	probably damaging	0.98
R1695:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R2017:Large1	UTSW	8	72852197	missense	probably damaging	1.00
R4835:Large1	UTSW	8	73048347	missense	probably damaging	1.00
R5105:Large1	UTSW	8	72852244	nonsense	probably null
R5120:Large1	UTSW	8	72859341	missense	probably damaging	1.00
R5135:Large1	UTSW	8	72818096	missense	probably benign	0.38
R5137:Large1	UTSW	8	73048309	missense	possibly damaging	0.58
R5567:Large1	UTSW	8	72837453	missense	possibly damaging	0.93
R5945:Large1	UTSW	8	72852200	missense	probably damaging	0.99
R6619:Large1	UTSW	8	72883264	nonsense	probably null
R6951:Large1	UTSW	8	73116419	missense	probably damaging	1.00
R7041:Large1	UTSW	8	73116464	missense	probably damaging	0.98
R7300:Large1	UTSW	8	72837596	missense	probably damaging	1.00
R7493:Large1	UTSW	8	72823715	missense	probably benign	0.23
R7877:Large1	UTSW	8	73116443	missense	probably damaging	1.00
R8118:Large1	UTSW	8	73131944	missense	probably benign	0.40
R8129:Large1	UTSW	8	72815957	missense	probably damaging	1.00
R8525:Large1	UTSW	8	72837492	missense	probably damaging	1.00
R8963:Large1	UTSW	8	72815984	missense	probably damaging	1.00
R9170:Large1	UTSW	8	72816017	missense	probably benign	0.00
R9653:Large1	UTSW	8	72837478	missense	probably benign
Z1088:Large1	UTSW	8	72912103	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTGCCACTTACAGTGAGGCAATC -3'
(R):5'- CGTATGGACTAAAGGCCATGCACC -3'

Sequencing Primer
(F):5'- GTGTCCAGTCATAAGCAGTAATCC -3'
(R):5'- CCCACAAACTTTGCCAAGTG -3'

Posted On

2013-05-23