Incidental Mutation 'R0477:Scin'
ID41870
Institutional Source Beutler Lab
Gene Symbol Scin
Ensembl Gene ENSMUSG00000002565
Gene Namescinderin
Synonymsadseverin
MMRRC Submission 038677-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0477 (G1)
Quality Score196
Status Validated (trace)
Chromosome12
Chromosomal Location40059769-40134228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40060516 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 711 (D711G)
Ref Sequence ENSEMBL: ENSMUSP00000002640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002640] [ENSMUST00000078481]
Predicted Effect probably damaging
Transcript: ENSMUST00000002640
AA Change: D711G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002640
Gene: ENSMUSG00000002565
AA Change: D711G

DomainStartEndE-ValueType
GEL 17 114 3.44e-26 SMART
GEL 135 227 3.92e-30 SMART
low complexity region 232 242 N/A INTRINSIC
GEL 252 347 6.56e-32 SMART
GEL 396 489 7.72e-29 SMART
GEL 510 596 2.33e-23 SMART
GEL 615 710 2.07e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078481
AA Change: D611G

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000077573
Gene: ENSMUSG00000002565
AA Change: D611G

DomainStartEndE-ValueType
GEL 17 114 3.44e-26 SMART
GEL 135 227 3.92e-30 SMART
low complexity region 232 242 N/A INTRINSIC
GEL 252 347 6.56e-32 SMART
GEL 396 489 7.72e-29 SMART
GEL 510 610 1.09e-28 SMART
Meta Mutation Damage Score 0.7673 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SCIN is a Ca(2+)-dependent actin-severing and -capping protein (Zunino et al., 2001 [PubMed 11568009]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a conditional allele knocked-out in osteoclasts exhibit impaired osteoclast differentiation and reduced peridontal disease-mediated bone loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A T 11: 117,802,961 I85F probably benign Het
Abca8a T A 11: 110,065,225 I778L probably benign Het
Abcc5 T C 16: 20,368,569 N889S possibly damaging Het
Abcc5 T C 16: 20,398,885 N359D probably damaging Het
Adam23 A G 1: 63,557,400 probably benign Het
Adamts3 A T 5: 89,684,507 D913E probably benign Het
Ap1b1 G T 11: 5,031,787 C538F probably benign Het
Ash1l T A 3: 88,983,459 S882T probably benign Het
C9 A T 15: 6,458,183 E43D probably benign Het
Cacna2d1 T C 5: 16,194,798 probably null Het
Ces2a A G 8: 104,737,537 E267G probably damaging Het
Cfap61 A G 2: 145,939,916 D23G probably damaging Het
Col9a3 T G 2: 180,609,470 probably benign Het
Cstl1 T C 2: 148,750,988 V21A probably benign Het
Cth A T 3: 157,905,175 L340Q probably damaging Het
Dnah8 T A 17: 30,755,080 M2813K probably damaging Het
Fam107a A T 14: 8,301,168 Y21N probably benign Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fer1l4 A G 2: 156,052,886 V21A probably benign Het
Foxc2 A T 8: 121,118,035 Y474F probably damaging Het
Hnf4g G T 3: 3,651,791 probably benign Het
Hnrnpll T C 17: 80,061,832 D54G unknown Het
Hydin A G 8: 110,418,498 Y827C probably damaging Het
Il23r A G 6: 67,452,377 V327A probably benign Het
Itih4 T A 14: 30,889,674 V118D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lamb1 A G 12: 31,326,269 D1546G possibly damaging Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Map1a T C 2: 121,302,101 S895P probably damaging Het
Mdn1 A C 4: 32,750,928 E4487A probably benign Het
Myo15 T C 11: 60,520,914 probably null Het
Nlrp4f C A 13: 65,190,906 R639L probably benign Het
Olfr1100 T A 2: 86,978,223 D191V probably damaging Het
Olfr1275 A G 2: 111,231,664 F43S probably benign Het
Pcdh9 T C 14: 93,887,678 N229S probably damaging Het
Pcnx2 A G 8: 125,761,567 V1746A probably damaging Het
Phf12 A T 11: 78,023,070 H446L possibly damaging Het
Phlpp2 A G 8: 109,895,506 probably null Het
Psmb9 A C 17: 34,182,264 V207G probably damaging Het
Ptprh C A 7: 4,597,998 D127Y possibly damaging Het
Rabep1 T G 11: 70,920,907 M535R probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Slfn4 T C 11: 83,188,681 I6T probably benign Het
Sos1 T A 17: 80,434,934 E388V possibly damaging Het
Spag5 A C 11: 78,314,198 Q603P probably damaging Het
Supv3l1 G T 10: 62,430,585 T604N probably damaging Het
Tbx5 A G 5: 119,883,119 S397G possibly damaging Het
Tmprss5 A G 9: 49,115,165 D383G possibly damaging Het
Trim43b A G 9: 89,090,601 W167R probably damaging Het
Unc80 A T 1: 66,570,001 D1283V probably damaging Het
Upf1 A T 8: 70,334,080 V918D probably benign Het
Vmn2r100 A G 17: 19,522,514 I383M probably benign Het
Zc3h3 G T 15: 75,777,083 S733R possibly damaging Het
Zcchc2 C T 1: 106,030,270 P426S possibly damaging Het
Zkscan7 A G 9: 122,890,809 probably null Het
Other mutations in Scin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Scin APN 12 40076972 missense probably benign 0.03
IGL01414:Scin APN 12 40124699 missense probably damaging 1.00
IGL01790:Scin APN 12 40063257 missense probably benign 0.02
IGL01807:Scin APN 12 40084289 missense probably damaging 1.00
IGL01946:Scin APN 12 40060491 utr 3 prime probably benign
IGL02040:Scin APN 12 40069453 intron probably benign
IGL02391:Scin APN 12 40077531 missense probably benign 0.05
IGL03221:Scin APN 12 40076974 missense probably benign 0.01
I1329:Scin UTSW 12 40073330 missense probably damaging 0.99
PIT4498001:Scin UTSW 12 40069447 critical splice acceptor site probably null
R0108:Scin UTSW 12 40127987 missense possibly damaging 0.68
R0470:Scin UTSW 12 40073292 splice site probably benign
R0538:Scin UTSW 12 40081771 missense probably damaging 0.98
R0539:Scin UTSW 12 40081766 missense possibly damaging 0.65
R0591:Scin UTSW 12 40080930 critical splice donor site probably null
R0668:Scin UTSW 12 40080949 missense probably damaging 1.00
R0718:Scin UTSW 12 40079607 missense probably damaging 1.00
R1473:Scin UTSW 12 40077502 missense probably benign
R1566:Scin UTSW 12 40081674 missense probably benign 0.17
R1570:Scin UTSW 12 40084381 splice site probably benign
R1624:Scin UTSW 12 40127930 missense probably benign
R1827:Scin UTSW 12 40068923 missense possibly damaging 0.88
R1836:Scin UTSW 12 40124698 missense probably damaging 1.00
R1985:Scin UTSW 12 40133908 critical splice donor site probably null
R2042:Scin UTSW 12 40077510 missense possibly damaging 0.96
R2061:Scin UTSW 12 40080948 missense probably damaging 1.00
R2147:Scin UTSW 12 40080985 missense probably benign 0.00
R2232:Scin UTSW 12 40068931 missense probably damaging 1.00
R2504:Scin UTSW 12 40081706 missense probably benign 0.02
R4781:Scin UTSW 12 40081764 missense possibly damaging 0.59
R4898:Scin UTSW 12 40104932 missense probably benign
R4914:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4915:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4916:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4917:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4918:Scin UTSW 12 40069374 missense possibly damaging 0.79
R5068:Scin UTSW 12 40124700 missense probably damaging 1.00
R5098:Scin UTSW 12 40077542 nonsense probably null
R5233:Scin UTSW 12 40077559 missense probably benign
R5564:Scin UTSW 12 40124569 missense probably benign
R5677:Scin UTSW 12 40063259 missense probably damaging 1.00
R5967:Scin UTSW 12 40077538 missense probably benign 0.35
R6027:Scin UTSW 12 40077516 missense probably damaging 1.00
R6130:Scin UTSW 12 40069436 missense probably benign 0.01
R6134:Scin UTSW 12 40060579 missense probably damaging 1.00
R6135:Scin UTSW 12 40079808 missense possibly damaging 0.80
R6439:Scin UTSW 12 40068946 missense probably damaging 0.99
R6613:Scin UTSW 12 40079715 missense probably benign 0.04
R7127:Scin UTSW 12 40105072 missense possibly damaging 0.69
R7234:Scin UTSW 12 40080958 nonsense probably null
R7431:Scin UTSW 12 40133922 missense probably damaging 1.00
R7609:Scin UTSW 12 40124589 missense probably damaging 1.00
R7665:Scin UTSW 12 40069415 missense probably damaging 1.00
R7704:Scin UTSW 12 40124688 missense possibly damaging 0.93
X0018:Scin UTSW 12 40069433 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAAATTGCTCGAAAACAAATGGTTG -3'
(R):5'- GCAGGTGAGAGAAATACCTGGAGACTTT -3'

Sequencing Primer
(F):5'- CAGCAATTCCCTTTGAAAGAGAAG -3'
(R):5'- GAATACTTGGGGCAAAAAGAATTTC -3'
Posted On2013-05-23