Incidental Mutation 'R0480:Upf2'
ID41891
Institutional Source Beutler Lab
Gene Symbol Upf2
Ensembl Gene ENSMUSG00000043241
Gene NameUPF2 regulator of nonsense transcripts homolog (yeast)
Synonyms
MMRRC Submission 038680-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0480 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location5951469-6056703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5957634 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 49 (V49A)
Ref Sequence ENSEMBL: ENSMUSP00000058375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060092]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060092
AA Change: V49A

PolyPhen 2 Score 0.706 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058375
Gene: ENSMUSG00000043241
AA Change: V49A

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
low complexity region 54 125 N/A INTRINSIC
MIF4G 167 363 1.22e-32 SMART
coiled coil region 514 543 N/A INTRINSIC
MIF4G 567 756 1.13e-50 SMART
MIF4G 771 984 3.43e-50 SMART
low complexity region 1023 1042 N/A INTRINSIC
Pfam:Upf2 1051 1215 1.5e-45 PFAM
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 99% (117/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located in the perinuclear area. It interacts with translation release factors and the proteins that are functional homologs of yeast Upf1p and Upf3p. Two splice variants have been found for this gene; both variants encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,880,186 L165F probably damaging Het
Adamts18 A G 8: 113,738,818 V714A possibly damaging Het
Adamtsl1 G T 4: 86,252,818 A518S probably benign Het
Adcy2 C T 13: 68,732,112 V363M probably damaging Het
Ago4 G T 4: 126,526,077 Q36K probably benign Het
Akr1a1 A G 4: 116,639,847 V172A possibly damaging Het
Alkbh2 T A 5: 114,125,535 N137I probably damaging Het
Ank3 T A 10: 69,879,926 S470T probably damaging Het
Ankrd12 T C 17: 66,049,828 T65A possibly damaging Het
Aox1 A T 1: 58,043,651 probably benign Het
Arhgap11a A T 2: 113,839,818 I320N probably benign Het
Arhgap17 G A 7: 123,294,644 H518Y probably damaging Het
Ascc3 T C 10: 50,735,252 V1563A probably damaging Het
Atf2 G A 2: 73,819,156 probably benign Het
Bmpr2 C T 1: 59,845,659 T268I probably damaging Het
Bpifb9a A G 2: 154,264,688 I380V probably benign Het
C2cd2 G A 16: 97,877,148 T363I probably benign Het
Catsperg2 T G 7: 29,721,298 N190H probably damaging Het
Ccdc138 T C 10: 58,561,967 L543S probably damaging Het
Ccdc170 A T 10: 4,518,939 K162N probably benign Het
Cdca5 G T 19: 6,090,298 R163L probably damaging Het
Cdh24 A G 14: 54,632,597 F239S probably benign Het
Cdkl3 T C 11: 52,005,055 V43A probably damaging Het
Cep152 G T 2: 125,581,719 Q921K possibly damaging Het
Cftr G A 6: 18,274,518 probably benign Het
Chmp5 T C 4: 40,948,690 probably benign Het
Cit T A 5: 115,933,393 probably benign Het
Cngb3 T A 4: 19,309,517 probably benign Het
Cnr2 A G 4: 135,917,601 E330G probably benign Het
Cyp21a1 A T 17: 34,801,826 L473Q probably damaging Het
Dchs1 T C 7: 105,771,489 T575A probably benign Het
Dedd2 A G 7: 25,203,625 V303A probably damaging Het
Dmd G T X: 84,425,738 A2370S probably benign Het
Dnah10 T A 5: 124,808,851 N3009K probably damaging Het
Dnajc13 G T 9: 104,200,509 N934K probably damaging Het
Dock1 C T 7: 134,737,718 L106F probably damaging Het
Fat3 A G 9: 15,997,729 Y2326H probably benign Het
Fhl5 A T 4: 25,207,101 C222* probably null Het
Gm10639 C T 9: 78,302,817 A135V probably benign Het
Gm1840 A G 8: 5,639,888 noncoding transcript Het
Gnmt T C 17: 46,725,928 T252A probably benign Het
Gtf2f1 A G 17: 57,004,307 probably null Het
Gtf3a T C 5: 146,953,229 Y187H probably damaging Het
Hdac2 A G 10: 36,974,792 Y14C probably damaging Het
Hnrnph1 T G 11: 50,385,762 probably benign Het
Homer2 T C 7: 81,618,603 D92G possibly damaging Het
Hspg2 T C 4: 137,550,024 S2885P probably damaging Het
Insr A G 8: 3,161,770 S1084P probably damaging Het
Ints11 T A 4: 155,887,624 V362E probably damaging Het
Kank2 T C 9: 21,779,899 N513S probably damaging Het
Kdelc1 C T 1: 44,110,757 W424* probably null Het
Kl T G 5: 150,953,288 V191G probably damaging Het
Krt23 A G 11: 99,486,698 probably null Het
Lama3 A C 18: 12,450,424 T690P possibly damaging Het
Lamb1 G A 12: 31,282,721 A281T possibly damaging Het
Lck T C 4: 129,555,640 E299G probably damaging Het
Lonrf1 A G 8: 36,222,710 V703A probably damaging Het
Ly6f T C 15: 75,271,677 C78R probably damaging Het
Mapkap1 C T 2: 34,533,781 probably benign Het
Mast1 T A 8: 84,913,089 I1204F probably damaging Het
Mbd6 C T 10: 127,285,873 probably benign Het
Mef2c A T 13: 83,592,901 T60S probably damaging Het
Mgat4c C T 10: 102,389,119 T398I probably damaging Het
Mmp12 C A 9: 7,350,016 H102Q probably damaging Het
Mmp20 G A 9: 7,645,373 G308E probably damaging Het
Mms19 A T 19: 41,954,846 L395Q probably damaging Het
Mus81 A G 19: 5,487,931 probably benign Het
Mypn C T 10: 63,193,203 R27H probably benign Het
Nav3 T C 10: 109,853,300 E372G probably damaging Het
Ncoa1 T A 12: 4,339,105 I57F probably damaging Het
Ncstn T C 1: 172,082,592 probably benign Het
Nefm C T 14: 68,124,159 D219N probably damaging Het
Notch2 C T 3: 98,146,537 T2172I possibly damaging Het
Obscn T A 11: 59,133,946 K423* probably null Het
Olfr1164 A C 2: 88,093,628 S103A probably benign Het
Olfr173 T C 16: 58,797,321 N175S probably benign Het
Olfr459 A T 6: 41,772,264 C12S probably benign Het
Olfr606 A G 7: 103,451,628 N97S probably benign Het
Ostm1 T A 10: 42,696,347 M242K probably damaging Het
Oxnad1 T A 14: 32,099,480 I154N probably damaging Het
Pcdhb10 T A 18: 37,413,099 D409E probably damaging Het
Pdcd11 T C 19: 47,125,037 probably benign Het
Peak1 C A 9: 56,258,632 V671L probably benign Het
Pex1 G A 5: 3,606,444 probably null Het
Plk4 T A 3: 40,805,640 F324I probably benign Het
Ppfibp1 C A 6: 147,019,031 probably null Het
Prcp T A 7: 92,919,082 W276R probably damaging Het
Prr14l T C 5: 32,829,880 E757G probably benign Het
Prss52 T A 14: 64,113,644 Y293N probably damaging Het
Prune2 A G 19: 17,006,792 probably benign Het
Ptprk G C 10: 28,585,947 A84P probably damaging Het
Ptprk C T 10: 28,585,948 A84V probably damaging Het
Rock1 A G 18: 10,079,120 L1116P possibly damaging Het
Sdha A T 13: 74,327,333 F526Y probably benign Het
Sema4b T C 7: 80,220,206 F414S probably damaging Het
Serpina12 T C 12: 104,035,701 D252G probably damaging Het
Siglecg C T 7: 43,411,126 A310V probably benign Het
Slc30a8 A G 15: 52,325,570 I194V probably benign Het
Spred3 A G 7: 29,162,975 S148P probably damaging Het
Taf9b A G X: 106,218,408 S58P probably damaging Het
Tgm4 A T 9: 123,062,419 Y109F probably benign Het
Tmprss11c T G 5: 86,237,609 probably benign Het
Tmtc3 A T 10: 100,471,404 V246D probably damaging Het
Tnip1 C T 11: 54,937,994 G116R probably damaging Het
Tpr A G 1: 150,428,241 E1455G possibly damaging Het
Ttc3 T A 16: 94,432,004 L986* probably null Het
Txndc15 A G 13: 55,724,623 I275V possibly damaging Het
Ugt2b1 T A 5: 86,926,456 I15L probably benign Het
Vmn1r117 G A 7: 20,883,446 P226S probably benign Het
Vmn2r28 A T 7: 5,490,457 H163Q probably benign Het
Vstm2a T A 11: 16,263,240 S208R probably damaging Het
Zfp346 T A 13: 55,113,097 C79* probably null Het
Zfp628 A T 7: 4,921,616 T946S probably benign Het
Other mutations in Upf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Upf2 APN 2 5961300 missense unknown
IGL01394:Upf2 APN 2 6040213 splice site probably null
IGL01571:Upf2 APN 2 6018939 unclassified probably benign
IGL01624:Upf2 APN 2 6034179 missense probably benign
IGL02121:Upf2 APN 2 6026323 splice site probably benign
IGL02485:Upf2 APN 2 6027291 missense unknown
IGL02491:Upf2 APN 2 6026164 missense unknown
R0265:Upf2 UTSW 2 6027204 splice site probably benign
R0390:Upf2 UTSW 2 6018894 unclassified probably benign
R0513:Upf2 UTSW 2 5957667 missense unknown
R0579:Upf2 UTSW 2 5988429 missense unknown
R0612:Upf2 UTSW 2 6034098 splice site probably benign
R0856:Upf2 UTSW 2 5957652 missense unknown
R1103:Upf2 UTSW 2 6026175 missense unknown
R1384:Upf2 UTSW 2 5960989 missense unknown
R1672:Upf2 UTSW 2 6040097 splice site probably null
R1728:Upf2 UTSW 2 6027450 missense probably damaging 1.00
R1784:Upf2 UTSW 2 6027450 missense probably damaging 1.00
R1836:Upf2 UTSW 2 6050324 splice site probably null
R2252:Upf2 UTSW 2 5961460 missense unknown
R2339:Upf2 UTSW 2 6040102 splice site probably benign
R3015:Upf2 UTSW 2 5976079 missense unknown
R3931:Upf2 UTSW 2 6047010 missense unknown
R4151:Upf2 UTSW 2 5961705 missense unknown
R4283:Upf2 UTSW 2 5973558 missense unknown
R4558:Upf2 UTSW 2 5973593 missense unknown
R4564:Upf2 UTSW 2 6027312 missense unknown
R5630:Upf2 UTSW 2 6027301 missense probably damaging 0.99
R6370:Upf2 UTSW 2 5976010 missense unknown
R6418:Upf2 UTSW 2 6027339 missense unknown
R6432:Upf2 UTSW 2 5979777 missense unknown
R7184:Upf2 UTSW 2 6023320 missense unknown
R7308:Upf2 UTSW 2 5973518 missense unknown
R7371:Upf2 UTSW 2 5961040 missense unknown
R7404:Upf2 UTSW 2 6040203 missense unknown
R7439:Upf2 UTSW 2 6018932 missense unknown
R7441:Upf2 UTSW 2 6018932 missense unknown
R7461:Upf2 UTSW 2 5973536 missense unknown
R7483:Upf2 UTSW 2 6027408 missense unknown
R7613:Upf2 UTSW 2 5973536 missense unknown
R7976:Upf2 UTSW 2 6026115 missense unknown
R8044:Upf2 UTSW 2 6029438 missense unknown
R8516:Upf2 UTSW 2 6018971 missense unknown
R8880:Upf2 UTSW 2 6026172 missense unknown
R8911:Upf2 UTSW 2 5983082 missense not run
Z1176:Upf2 UTSW 2 6023388 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGCAGCACCGTGCTACTTCATAG -3'
(R):5'- AACCTCACGAATGGTCAGGGGAAC -3'

Sequencing Primer
(F):5'- GATGTTAAATAAAAGCCACTCTGCC -3'
(R):5'- CTTGGCCTGctcctcctg -3'
Posted On2013-05-23