Incidental Mutation 'R0480:Atf2'
ID41893
Institutional Source Beutler Lab
Gene Symbol Atf2
Ensembl Gene ENSMUSG00000027104
Gene Nameactivating transcription factor 2
SynonymsD130078H02Rik, mXBP, Creb2, ATF-2, CRE-BP
MMRRC Submission 038680-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R0480 (G1)
Quality Score193
Status Validated
Chromosome2
Chromosomal Location73816509-73892639 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 73819156 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055833] [ENSMUST00000090802] [ENSMUST00000100009] [ENSMUST00000112007] [ENSMUST00000112010] [ENSMUST00000112016] [ENSMUST00000112017] [ENSMUST00000173010]
Predicted Effect probably benign
Transcript: ENSMUST00000055833
SMART Domains Protein: ENSMUSP00000058521
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090802
SMART Domains Protein: ENSMUSP00000088311
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100009
SMART Domains Protein: ENSMUSP00000097588
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112007
SMART Domains Protein: ENSMUSP00000107638
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112010
SMART Domains Protein: ENSMUSP00000107641
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112016
SMART Domains Protein: ENSMUSP00000107647
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 139 156 N/A INTRINSIC
low complexity region 202 218 N/A INTRINSIC
BRLZ 234 298 3.15e-21 SMART
low complexity region 339 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112017
SMART Domains Protein: ENSMUSP00000107648
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124737
SMART Domains Protein: ENSMUSP00000114828
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
BRLZ 126 190 3.89e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156455
Predicted Effect probably benign
Transcript: ENSMUST00000173010
SMART Domains Protein: ENSMUSP00000133632
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 377 1.32e-5 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 99% (117/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions This protein binds to the cAMP-responsive element (CRE), an octameric palindrome. It forms a homodimer or a heterodimer with c-Jun and stimulates CRE-dependent transcription. This protein is also a histone acetyltransferase (HAT) that specifically acetylates histones H2B and H4 in vitro; thus it may represent a class of sequence-specific factors that activate transcription by direct effects on chromatin components. The encoded protein may also be involved in cell's DNA damage response independent of its role in transcriptional regulation. Several alternatively spliced transcript variants have been found for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous mutation of this gene results in increased postnatal lethality, skeletal development defects, runting, decreased hearing, inner ear and brain abnormalities, hyperactivity, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,880,186 L165F probably damaging Het
Adamts18 A G 8: 113,738,818 V714A possibly damaging Het
Adamtsl1 G T 4: 86,252,818 A518S probably benign Het
Adcy2 C T 13: 68,732,112 V363M probably damaging Het
Ago4 G T 4: 126,526,077 Q36K probably benign Het
Akr1a1 A G 4: 116,639,847 V172A possibly damaging Het
Alkbh2 T A 5: 114,125,535 N137I probably damaging Het
Ank3 T A 10: 69,879,926 S470T probably damaging Het
Ankrd12 T C 17: 66,049,828 T65A possibly damaging Het
Aox1 A T 1: 58,043,651 probably benign Het
Arhgap11a A T 2: 113,839,818 I320N probably benign Het
Arhgap17 G A 7: 123,294,644 H518Y probably damaging Het
Ascc3 T C 10: 50,735,252 V1563A probably damaging Het
Bmpr2 C T 1: 59,845,659 T268I probably damaging Het
Bpifb9a A G 2: 154,264,688 I380V probably benign Het
C2cd2 G A 16: 97,877,148 T363I probably benign Het
Catsperg2 T G 7: 29,721,298 N190H probably damaging Het
Ccdc138 T C 10: 58,561,967 L543S probably damaging Het
Ccdc170 A T 10: 4,518,939 K162N probably benign Het
Cdca5 G T 19: 6,090,298 R163L probably damaging Het
Cdh24 A G 14: 54,632,597 F239S probably benign Het
Cdkl3 T C 11: 52,005,055 V43A probably damaging Het
Cep152 G T 2: 125,581,719 Q921K possibly damaging Het
Cftr G A 6: 18,274,518 probably benign Het
Chmp5 T C 4: 40,948,690 probably benign Het
Cit T A 5: 115,933,393 probably benign Het
Cngb3 T A 4: 19,309,517 probably benign Het
Cnr2 A G 4: 135,917,601 E330G probably benign Het
Cyp21a1 A T 17: 34,801,826 L473Q probably damaging Het
Dchs1 T C 7: 105,771,489 T575A probably benign Het
Dedd2 A G 7: 25,203,625 V303A probably damaging Het
Dmd G T X: 84,425,738 A2370S probably benign Het
Dnah10 T A 5: 124,808,851 N3009K probably damaging Het
Dnajc13 G T 9: 104,200,509 N934K probably damaging Het
Dock1 C T 7: 134,737,718 L106F probably damaging Het
Fat3 A G 9: 15,997,729 Y2326H probably benign Het
Fhl5 A T 4: 25,207,101 C222* probably null Het
Gm10639 C T 9: 78,302,817 A135V probably benign Het
Gm1840 A G 8: 5,639,888 noncoding transcript Het
Gnmt T C 17: 46,725,928 T252A probably benign Het
Gtf2f1 A G 17: 57,004,307 probably null Het
Gtf3a T C 5: 146,953,229 Y187H probably damaging Het
Hdac2 A G 10: 36,974,792 Y14C probably damaging Het
Hnrnph1 T G 11: 50,385,762 probably benign Het
Homer2 T C 7: 81,618,603 D92G possibly damaging Het
Hspg2 T C 4: 137,550,024 S2885P probably damaging Het
Insr A G 8: 3,161,770 S1084P probably damaging Het
Ints11 T A 4: 155,887,624 V362E probably damaging Het
Kank2 T C 9: 21,779,899 N513S probably damaging Het
Kdelc1 C T 1: 44,110,757 W424* probably null Het
Kl T G 5: 150,953,288 V191G probably damaging Het
Krt23 A G 11: 99,486,698 probably null Het
Lama3 A C 18: 12,450,424 T690P possibly damaging Het
Lamb1 G A 12: 31,282,721 A281T possibly damaging Het
Lck T C 4: 129,555,640 E299G probably damaging Het
Lonrf1 A G 8: 36,222,710 V703A probably damaging Het
Ly6f T C 15: 75,271,677 C78R probably damaging Het
Mapkap1 C T 2: 34,533,781 probably benign Het
Mast1 T A 8: 84,913,089 I1204F probably damaging Het
Mbd6 C T 10: 127,285,873 probably benign Het
Mef2c A T 13: 83,592,901 T60S probably damaging Het
Mgat4c C T 10: 102,389,119 T398I probably damaging Het
Mmp12 C A 9: 7,350,016 H102Q probably damaging Het
Mmp20 G A 9: 7,645,373 G308E probably damaging Het
Mms19 A T 19: 41,954,846 L395Q probably damaging Het
Mus81 A G 19: 5,487,931 probably benign Het
Mypn C T 10: 63,193,203 R27H probably benign Het
Nav3 T C 10: 109,853,300 E372G probably damaging Het
Ncoa1 T A 12: 4,339,105 I57F probably damaging Het
Ncstn T C 1: 172,082,592 probably benign Het
Nefm C T 14: 68,124,159 D219N probably damaging Het
Notch2 C T 3: 98,146,537 T2172I possibly damaging Het
Obscn T A 11: 59,133,946 K423* probably null Het
Olfr1164 A C 2: 88,093,628 S103A probably benign Het
Olfr173 T C 16: 58,797,321 N175S probably benign Het
Olfr459 A T 6: 41,772,264 C12S probably benign Het
Olfr606 A G 7: 103,451,628 N97S probably benign Het
Ostm1 T A 10: 42,696,347 M242K probably damaging Het
Oxnad1 T A 14: 32,099,480 I154N probably damaging Het
Pcdhb10 T A 18: 37,413,099 D409E probably damaging Het
Pdcd11 T C 19: 47,125,037 probably benign Het
Peak1 C A 9: 56,258,632 V671L probably benign Het
Pex1 G A 5: 3,606,444 probably null Het
Plk4 T A 3: 40,805,640 F324I probably benign Het
Ppfibp1 C A 6: 147,019,031 probably null Het
Prcp T A 7: 92,919,082 W276R probably damaging Het
Prr14l T C 5: 32,829,880 E757G probably benign Het
Prss52 T A 14: 64,113,644 Y293N probably damaging Het
Prune2 A G 19: 17,006,792 probably benign Het
Ptprk G C 10: 28,585,947 A84P probably damaging Het
Ptprk C T 10: 28,585,948 A84V probably damaging Het
Rock1 A G 18: 10,079,120 L1116P possibly damaging Het
Sdha A T 13: 74,327,333 F526Y probably benign Het
Sema4b T C 7: 80,220,206 F414S probably damaging Het
Serpina12 T C 12: 104,035,701 D252G probably damaging Het
Siglecg C T 7: 43,411,126 A310V probably benign Het
Slc30a8 A G 15: 52,325,570 I194V probably benign Het
Spred3 A G 7: 29,162,975 S148P probably damaging Het
Taf9b A G X: 106,218,408 S58P probably damaging Het
Tgm4 A T 9: 123,062,419 Y109F probably benign Het
Tmprss11c T G 5: 86,237,609 probably benign Het
Tmtc3 A T 10: 100,471,404 V246D probably damaging Het
Tnip1 C T 11: 54,937,994 G116R probably damaging Het
Tpr A G 1: 150,428,241 E1455G possibly damaging Het
Ttc3 T A 16: 94,432,004 L986* probably null Het
Txndc15 A G 13: 55,724,623 I275V possibly damaging Het
Ugt2b1 T A 5: 86,926,456 I15L probably benign Het
Upf2 T C 2: 5,957,634 V49A possibly damaging Het
Vmn1r117 G A 7: 20,883,446 P226S probably benign Het
Vmn2r28 A T 7: 5,490,457 H163Q probably benign Het
Vstm2a T A 11: 16,263,240 S208R probably damaging Het
Zfp346 T A 13: 55,113,097 C79* probably null Het
Zfp628 A T 7: 4,921,616 T946S probably benign Het
Other mutations in Atf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Atf2 APN 2 73845503 missense possibly damaging 0.85
IGL01608:Atf2 APN 2 73819078 missense probably damaging 1.00
IGL02112:Atf2 APN 2 73819037 missense probably damaging 1.00
IGL02469:Atf2 APN 2 73846332 missense probably damaging 0.99
IGL02686:Atf2 APN 2 73845500 missense possibly damaging 0.90
IGL03381:Atf2 APN 2 73828668 missense probably benign 0.13
R0020:Atf2 UTSW 2 73846284 missense possibly damaging 0.81
R0020:Atf2 UTSW 2 73846284 missense possibly damaging 0.81
R0045:Atf2 UTSW 2 73829856 missense probably benign 0.02
R0045:Atf2 UTSW 2 73829856 missense probably benign 0.02
R0732:Atf2 UTSW 2 73845500 missense possibly damaging 0.90
R1188:Atf2 UTSW 2 73845537 missense probably damaging 0.96
R1285:Atf2 UTSW 2 73845509 missense probably damaging 1.00
R1287:Atf2 UTSW 2 73845509 missense probably damaging 1.00
R1523:Atf2 UTSW 2 73863208 missense probably damaging 1.00
R1622:Atf2 UTSW 2 73853789 splice site probably null
R1731:Atf2 UTSW 2 73845509 missense probably damaging 1.00
R1935:Atf2 UTSW 2 73846219 missense probably damaging 1.00
R1939:Atf2 UTSW 2 73846219 missense probably damaging 1.00
R1965:Atf2 UTSW 2 73850898 missense possibly damaging 0.87
R2000:Atf2 UTSW 2 73863240 critical splice acceptor site probably null
R2045:Atf2 UTSW 2 73863208 missense probably damaging 1.00
R2256:Atf2 UTSW 2 73845511 splice site probably null
R3147:Atf2 UTSW 2 73850939 splice site probably null
R3890:Atf2 UTSW 2 73863213 missense probably damaging 1.00
R4680:Atf2 UTSW 2 73828681 splice site probably null
R4715:Atf2 UTSW 2 73823300 missense probably damaging 1.00
R5161:Atf2 UTSW 2 73829790 critical splice donor site probably null
R5853:Atf2 UTSW 2 73828469 splice site probably null
R7419:Atf2 UTSW 2 73842433 missense probably benign 0.01
R7833:Atf2 UTSW 2 73853885 missense possibly damaging 0.94
X0033:Atf2 UTSW 2 73846281 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ATCTGTGAAAGTGCAGGCTCCG -3'
(R):5'- CCCTATTTAGCAAGTATGCACACCCTC -3'

Sequencing Primer
(F):5'- GTGCTCTGGTCCGCCATC -3'
(R):5'- GGTACACACCTGTGACTTCATTTAG -3'
Posted On2013-05-23