Incidental Mutation 'R0480:Adamtsl1'
ID41903
Institutional Source Beutler Lab
Gene Symbol Adamtsl1
Ensembl Gene ENSMUSG00000066113
Gene NameADAMTS-like 1
Synonyms5930437A14Rik, 6720426B09Rik, punctin-1
MMRRC Submission 038680-MU
Accession Numbers

Genbank: NM_172542; MGI: 1924989; Ensembl: ENSMUST00000141889

Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R0480 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location85514172-86428385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86252818 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 518 (A518S)
Ref Sequence ENSEMBL: ENSMUSP00000119278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048885] [ENSMUST00000107178] [ENSMUST00000141889]
Predicted Effect probably benign
Transcript: ENSMUST00000048885
AA Change: A518S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000043073
Gene: ENSMUSG00000066113
AA Change: A518S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
TSP1 36 82 8.95e-7 SMART
TSP1 301 360 4.35e-2 SMART
TSP1 379 438 2.05e-2 SMART
TSP1 439 493 3.99e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107178
AA Change: A501S

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102796
Gene: ENSMUSG00000066113
AA Change: A501S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
TSP1 36 82 8.95e-7 SMART
TSP1 301 360 4.35e-2 SMART
TSP1 362 421 2.05e-2 SMART
TSP1 422 476 3.99e-4 SMART
TSP1 508 567 6.39e-3 SMART
TSP1 593 650 7.86e-3 SMART
TSP1 652 712 3.78e-5 SMART
TSP1 715 772 2.66e-2 SMART
TSP1 774 833 1.62e-4 SMART
IGc2 873 937 4.19e-6 SMART
low complexity region 1123 1142 N/A INTRINSIC
IGc2 1175 1240 1.31e-7 SMART
IGc2 1282 1351 7.81e-15 SMART
IGc2 1400 1467 2.39e-10 SMART
TSP1 1481 1537 2.12e-1 SMART
TSP1 1540 1599 1.74e-4 SMART
TSP1 1600 1658 8.2e0 SMART
TSP1 1660 1717 1.96e-1 SMART
Pfam:PLAC 1721 1751 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136320
SMART Domains Protein: ENSMUSP00000123343
Gene: ENSMUSG00000066113

DomainStartEndE-ValueType
Pfam:ADAM_spacer1 15 125 2.7e-7 PFAM
TSP1 130 189 4.35e-2 SMART
TSP1 191 239 1.36e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141889
AA Change: A518S

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000119278
Gene: ENSMUSG00000066113
AA Change: A518S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
TSP1 36 82 8.95e-7 SMART
TSP1 301 360 4.35e-2 SMART
TSP1 379 438 2.05e-2 SMART
TSP1 439 493 3.99e-4 SMART
TSP1 525 584 6.39e-3 SMART
TSP1 610 667 7.86e-3 SMART
TSP1 707 764 2.66e-2 SMART
TSP1 766 825 1.62e-4 SMART
IGc2 865 929 4.19e-6 SMART
low complexity region 1115 1134 N/A INTRINSIC
IGc2 1167 1232 1.31e-7 SMART
IGc2 1274 1343 7.81e-15 SMART
IGc2 1392 1459 2.39e-10 SMART
TSP1 1473 1529 2.12e-1 SMART
TSP1 1532 1591 1.74e-4 SMART
TSP1 1592 1650 8.2e0 SMART
TSP1 1652 1709 1.96e-1 SMART
Pfam:PLAC 1712 1744 5.6e-12 PFAM
Meta Mutation Damage Score 0.0873 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 99% (117/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,880,186 L165F probably damaging Het
Adamts18 A G 8: 113,738,818 V714A possibly damaging Het
Adcy2 C T 13: 68,732,112 V363M probably damaging Het
Ago4 G T 4: 126,526,077 Q36K probably benign Het
Akr1a1 A G 4: 116,639,847 V172A possibly damaging Het
Alkbh2 T A 5: 114,125,535 N137I probably damaging Het
Ank3 T A 10: 69,879,926 S470T probably damaging Het
Ankrd12 T C 17: 66,049,828 T65A possibly damaging Het
Aox1 A T 1: 58,043,651 probably benign Het
Arhgap11a A T 2: 113,839,818 I320N probably benign Het
Arhgap17 G A 7: 123,294,644 H518Y probably damaging Het
Ascc3 T C 10: 50,735,252 V1563A probably damaging Het
Atf2 G A 2: 73,819,156 probably benign Het
Bmpr2 C T 1: 59,845,659 T268I probably damaging Het
Bpifb9a A G 2: 154,264,688 I380V probably benign Het
C2cd2 G A 16: 97,877,148 T363I probably benign Het
Catsperg2 T G 7: 29,721,298 N190H probably damaging Het
Ccdc138 T C 10: 58,561,967 L543S probably damaging Het
Ccdc170 A T 10: 4,518,939 K162N probably benign Het
Cdca5 G T 19: 6,090,298 R163L probably damaging Het
Cdh24 A G 14: 54,632,597 F239S probably benign Het
Cdkl3 T C 11: 52,005,055 V43A probably damaging Het
Cep152 G T 2: 125,581,719 Q921K possibly damaging Het
Cftr G A 6: 18,274,518 probably benign Het
Chmp5 T C 4: 40,948,690 probably benign Het
Cit T A 5: 115,933,393 probably benign Het
Cngb3 T A 4: 19,309,517 probably benign Het
Cnr2 A G 4: 135,917,601 E330G probably benign Het
Cyp21a1 A T 17: 34,801,826 L473Q probably damaging Het
Dchs1 T C 7: 105,771,489 T575A probably benign Het
Dedd2 A G 7: 25,203,625 V303A probably damaging Het
Dmd G T X: 84,425,738 A2370S probably benign Het
Dnah10 T A 5: 124,808,851 N3009K probably damaging Het
Dnajc13 G T 9: 104,200,509 N934K probably damaging Het
Dock1 C T 7: 134,737,718 L106F probably damaging Het
Fat3 A G 9: 15,997,729 Y2326H probably benign Het
Fhl5 A T 4: 25,207,101 C222* probably null Het
Gm10639 C T 9: 78,302,817 A135V probably benign Het
Gm1840 A G 8: 5,639,888 noncoding transcript Het
Gnmt T C 17: 46,725,928 T252A probably benign Het
Gtf2f1 A G 17: 57,004,307 probably null Het
Gtf3a T C 5: 146,953,229 Y187H probably damaging Het
Hdac2 A G 10: 36,974,792 Y14C probably damaging Het
Hnrnph1 T G 11: 50,385,762 probably benign Het
Homer2 T C 7: 81,618,603 D92G possibly damaging Het
Hspg2 T C 4: 137,550,024 S2885P probably damaging Het
Insr A G 8: 3,161,770 S1084P probably damaging Het
Ints11 T A 4: 155,887,624 V362E probably damaging Het
Kank2 T C 9: 21,779,899 N513S probably damaging Het
Kdelc1 C T 1: 44,110,757 W424* probably null Het
Kl T G 5: 150,953,288 V191G probably damaging Het
Krt23 A G 11: 99,486,698 probably null Het
Lama3 A C 18: 12,450,424 T690P possibly damaging Het
Lamb1 G A 12: 31,282,721 A281T possibly damaging Het
Lck T C 4: 129,555,640 E299G probably damaging Het
Lonrf1 A G 8: 36,222,710 V703A probably damaging Het
Ly6f T C 15: 75,271,677 C78R probably damaging Het
Mapkap1 C T 2: 34,533,781 probably benign Het
Mast1 T A 8: 84,913,089 I1204F probably damaging Het
Mbd6 C T 10: 127,285,873 probably benign Het
Mef2c A T 13: 83,592,901 T60S probably damaging Het
Mgat4c C T 10: 102,389,119 T398I probably damaging Het
Mmp12 C A 9: 7,350,016 H102Q probably damaging Het
Mmp20 G A 9: 7,645,373 G308E probably damaging Het
Mms19 A T 19: 41,954,846 L395Q probably damaging Het
Mus81 A G 19: 5,487,931 probably benign Het
Mypn C T 10: 63,193,203 R27H probably benign Het
Nav3 T C 10: 109,853,300 E372G probably damaging Het
Ncoa1 T A 12: 4,339,105 I57F probably damaging Het
Ncstn T C 1: 172,082,592 probably benign Het
Nefm C T 14: 68,124,159 D219N probably damaging Het
Notch2 C T 3: 98,146,537 T2172I possibly damaging Het
Obscn T A 11: 59,133,946 K423* probably null Het
Olfr1164 A C 2: 88,093,628 S103A probably benign Het
Olfr173 T C 16: 58,797,321 N175S probably benign Het
Olfr459 A T 6: 41,772,264 C12S probably benign Het
Olfr606 A G 7: 103,451,628 N97S probably benign Het
Ostm1 T A 10: 42,696,347 M242K probably damaging Het
Oxnad1 T A 14: 32,099,480 I154N probably damaging Het
Pcdhb10 T A 18: 37,413,099 D409E probably damaging Het
Pdcd11 T C 19: 47,125,037 probably benign Het
Peak1 C A 9: 56,258,632 V671L probably benign Het
Pex1 G A 5: 3,606,444 probably null Het
Plk4 T A 3: 40,805,640 F324I probably benign Het
Ppfibp1 C A 6: 147,019,031 probably null Het
Prcp T A 7: 92,919,082 W276R probably damaging Het
Prr14l T C 5: 32,829,880 E757G probably benign Het
Prss52 T A 14: 64,113,644 Y293N probably damaging Het
Prune2 A G 19: 17,006,792 probably benign Het
Ptprk G C 10: 28,585,947 A84P probably damaging Het
Ptprk C T 10: 28,585,948 A84V probably damaging Het
Rock1 A G 18: 10,079,120 L1116P possibly damaging Het
Sdha A T 13: 74,327,333 F526Y probably benign Het
Sema4b T C 7: 80,220,206 F414S probably damaging Het
Serpina12 T C 12: 104,035,701 D252G probably damaging Het
Siglecg C T 7: 43,411,126 A310V probably benign Het
Slc30a8 A G 15: 52,325,570 I194V probably benign Het
Spred3 A G 7: 29,162,975 S148P probably damaging Het
Taf9b A G X: 106,218,408 S58P probably damaging Het
Tgm4 A T 9: 123,062,419 Y109F probably benign Het
Tmprss11c T G 5: 86,237,609 probably benign Het
Tmtc3 A T 10: 100,471,404 V246D probably damaging Het
Tnip1 C T 11: 54,937,994 G116R probably damaging Het
Tpr A G 1: 150,428,241 E1455G possibly damaging Het
Ttc3 T A 16: 94,432,004 L986* probably null Het
Txndc15 A G 13: 55,724,623 I275V possibly damaging Het
Ugt2b1 T A 5: 86,926,456 I15L probably benign Het
Upf2 T C 2: 5,957,634 V49A possibly damaging Het
Vmn1r117 G A 7: 20,883,446 P226S probably benign Het
Vmn2r28 A T 7: 5,490,457 H163Q probably benign Het
Vstm2a T A 11: 16,263,240 S208R probably damaging Het
Zfp346 T A 13: 55,113,097 C79* probably null Het
Zfp628 A T 7: 4,921,616 T946S probably benign Het
Other mutations in Adamtsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Adamtsl1 APN 4 86385640 missense probably benign 0.01
IGL00741:Adamtsl1 APN 4 86276948 missense probably damaging 1.00
IGL00770:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00774:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00826:Adamtsl1 APN 4 86156804 missense probably damaging 1.00
IGL00938:Adamtsl1 APN 4 86342278 missense possibly damaging 0.93
IGL01012:Adamtsl1 APN 4 86342189 missense possibly damaging 0.93
IGL01728:Adamtsl1 APN 4 86110837 missense probably damaging 1.00
IGL01801:Adamtsl1 APN 4 86199322 missense probably benign 0.23
IGL01922:Adamtsl1 APN 4 86249902 missense probably damaging 1.00
IGL02006:Adamtsl1 APN 4 86199345 missense probably damaging 1.00
IGL02192:Adamtsl1 APN 4 86228016 missense probably damaging 1.00
IGL02351:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02358:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02373:Adamtsl1 APN 4 86249805 missense probably damaging 1.00
IGL02660:Adamtsl1 APN 4 86232610 missense probably damaging 1.00
IGL02964:Adamtsl1 APN 4 86424357 missense probably damaging 1.00
IGL03233:Adamtsl1 APN 4 86342120 missense probably damaging 1.00
IGL03297:Adamtsl1 APN 4 86423426 missense probably damaging 0.98
IGL03326:Adamtsl1 APN 4 86252748 splice site probably benign
PIT4378001:Adamtsl1 UTSW 4 86199364 missense possibly damaging 0.93
PIT4418001:Adamtsl1 UTSW 4 86243724 missense probably damaging 1.00
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0132:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0453:Adamtsl1 UTSW 4 86232615 missense probably damaging 1.00
R0496:Adamtsl1 UTSW 4 86341198 missense probably damaging 1.00
R0538:Adamtsl1 UTSW 4 86343121 missense probably benign 0.27
R0547:Adamtsl1 UTSW 4 86356355 missense probably benign 0.37
R0567:Adamtsl1 UTSW 4 86228016 missense probably damaging 1.00
R0568:Adamtsl1 UTSW 4 86418552 missense probably damaging 1.00
R0639:Adamtsl1 UTSW 4 86277143 missense probably damaging 1.00
R0931:Adamtsl1 UTSW 4 86249847 missense probably benign 0.05
R1186:Adamtsl1 UTSW 4 86388509 missense probably benign 0.00
R1387:Adamtsl1 UTSW 4 86374993 splice site probably benign
R1459:Adamtsl1 UTSW 4 86425865 missense probably damaging 1.00
R1518:Adamtsl1 UTSW 4 86342603 missense probably damaging 0.99
R1532:Adamtsl1 UTSW 4 86248065 missense probably benign 0.02
R1603:Adamtsl1 UTSW 4 86415530 missense probably benign
R1931:Adamtsl1 UTSW 4 86342411 missense possibly damaging 0.62
R2086:Adamtsl1 UTSW 4 86228012 missense probably damaging 1.00
R2221:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2223:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2396:Adamtsl1 UTSW 4 86343119 nonsense probably null
R2397:Adamtsl1 UTSW 4 86199357 missense probably damaging 1.00
R2426:Adamtsl1 UTSW 4 86156788 missense probably benign 0.01
R3121:Adamtsl1 UTSW 4 86337009 missense probably damaging 1.00
R3715:Adamtsl1 UTSW 4 86216976 missense probably benign 0.01
R3848:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3849:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3850:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R4194:Adamtsl1 UTSW 4 86054008 intron probably benign
R4354:Adamtsl1 UTSW 4 86156684 missense probably damaging 1.00
R4795:Adamtsl1 UTSW 4 86243769 critical splice donor site probably null
R4830:Adamtsl1 UTSW 4 86356382 missense probably damaging 0.97
R4874:Adamtsl1 UTSW 4 86342492 missense possibly damaging 0.94
R4939:Adamtsl1 UTSW 4 86243725 missense possibly damaging 0.95
R4942:Adamtsl1 UTSW 4 86341214 nonsense probably null
R4947:Adamtsl1 UTSW 4 85764800 missense possibly damaging 0.93
R4960:Adamtsl1 UTSW 4 86424173 nonsense probably null
R4971:Adamtsl1 UTSW 4 86336931 missense probably damaging 1.00
R5141:Adamtsl1 UTSW 4 86156850 missense possibly damaging 0.77
R5213:Adamtsl1 UTSW 4 86385628 missense possibly damaging 0.89
R5237:Adamtsl1 UTSW 4 86385669 critical splice donor site probably null
R5250:Adamtsl1 UTSW 4 86216945 nonsense probably null
R5411:Adamtsl1 UTSW 4 86388413 critical splice acceptor site probably null
R5554:Adamtsl1 UTSW 4 86276945 missense possibly damaging 0.69
R5631:Adamtsl1 UTSW 4 86276923 nonsense probably null
R5739:Adamtsl1 UTSW 4 86232664 missense probably damaging 1.00
R5905:Adamtsl1 UTSW 4 86342324 missense probably damaging 1.00
R6028:Adamtsl1 UTSW 4 86342324 missense probably damaging 1.00
R6044:Adamtsl1 UTSW 4 86212691 missense probably damaging 1.00
R6261:Adamtsl1 UTSW 4 86336878 missense probably benign 0.09
R6300:Adamtsl1 UTSW 4 86248017 missense probably damaging 1.00
R6332:Adamtsl1 UTSW 4 86217011 missense probably damaging 0.96
R6560:Adamtsl1 UTSW 4 86336893 missense probably damaging 1.00
R6693:Adamtsl1 UTSW 4 86342886 missense probably benign 0.27
R6736:Adamtsl1 UTSW 4 86342247 missense probably damaging 1.00
R6964:Adamtsl1 UTSW 4 86156854 missense probably damaging 1.00
R7064:Adamtsl1 UTSW 4 86342041 missense possibly damaging 0.80
R7434:Adamtsl1 UTSW 4 86425878 missense probably damaging 0.99
R7477:Adamtsl1 UTSW 4 86415651 missense probably damaging 1.00
R7545:Adamtsl1 UTSW 4 85764855 missense probably damaging 1.00
R7556:Adamtsl1 UTSW 4 86277121 missense probably benign 0.19
R7580:Adamtsl1 UTSW 4 86054064 missense possibly damaging 0.53
R7593:Adamtsl1 UTSW 4 86341213 missense probably damaging 1.00
R7710:Adamtsl1 UTSW 4 86232573 missense
Predicted Primers PCR Primer
(F):5'- GTCCTCAGAAACAGCTATTTGCCCC -3'
(R):5'- GGCAAGCACCTCATTTGTATCTCCC -3'

Sequencing Primer
(F):5'- TGCAATTACCAGCATGACTTC -3'
(R):5'- GTATCTCCCTGTCAGGTAAAACTG -3'
Posted On2013-05-23