Incidental Mutation 'R0480:Catsperg2'
ID41925
Institutional Source Beutler Lab
Gene Symbol Catsperg2
Ensembl Gene ENSMUSG00000049123
Gene Namecation channel sperm associated auxiliary subunit gamma 2
Synonyms1700067C01Rik, CATSPERG
MMRRC Submission 038680-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R0480 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29697219-29727032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 29721298 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 190 (N190H)
Ref Sequence ENSEMBL: ENSMUSP00000147099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061193] [ENSMUST00000207115] [ENSMUST00000208371] [ENSMUST00000208607] [ENSMUST00000209126]
Predicted Effect probably damaging
Transcript: ENSMUST00000061193
AA Change: N190H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052285
Gene: ENSMUSG00000049123
AA Change: N190H

DomainStartEndE-ValueType
Pfam:CATSPERG 2 973 N/A PFAM
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1106 1118 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207115
AA Change: N70H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208345
Predicted Effect probably benign
Transcript: ENSMUST00000208371
Predicted Effect probably damaging
Transcript: ENSMUST00000208607
AA Change: N190H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000209126
AA Change: N190H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.1522 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 99% (117/118)
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,880,186 L165F probably damaging Het
Adamts18 A G 8: 113,738,818 V714A possibly damaging Het
Adamtsl1 G T 4: 86,252,818 A518S probably benign Het
Adcy2 C T 13: 68,732,112 V363M probably damaging Het
Ago4 G T 4: 126,526,077 Q36K probably benign Het
Akr1a1 A G 4: 116,639,847 V172A possibly damaging Het
Alkbh2 T A 5: 114,125,535 N137I probably damaging Het
Ank3 T A 10: 69,879,926 S470T probably damaging Het
Ankrd12 T C 17: 66,049,828 T65A possibly damaging Het
Aox1 A T 1: 58,043,651 probably benign Het
Arhgap11a A T 2: 113,839,818 I320N probably benign Het
Arhgap17 G A 7: 123,294,644 H518Y probably damaging Het
Ascc3 T C 10: 50,735,252 V1563A probably damaging Het
Atf2 G A 2: 73,819,156 probably benign Het
Bmpr2 C T 1: 59,845,659 T268I probably damaging Het
Bpifb9a A G 2: 154,264,688 I380V probably benign Het
C2cd2 G A 16: 97,877,148 T363I probably benign Het
Ccdc138 T C 10: 58,561,967 L543S probably damaging Het
Ccdc170 A T 10: 4,518,939 K162N probably benign Het
Cdca5 G T 19: 6,090,298 R163L probably damaging Het
Cdh24 A G 14: 54,632,597 F239S probably benign Het
Cdkl3 T C 11: 52,005,055 V43A probably damaging Het
Cep152 G T 2: 125,581,719 Q921K possibly damaging Het
Cftr G A 6: 18,274,518 probably benign Het
Chmp5 T C 4: 40,948,690 probably benign Het
Cit T A 5: 115,933,393 probably benign Het
Cngb3 T A 4: 19,309,517 probably benign Het
Cnr2 A G 4: 135,917,601 E330G probably benign Het
Cyp21a1 A T 17: 34,801,826 L473Q probably damaging Het
Dchs1 T C 7: 105,771,489 T575A probably benign Het
Dedd2 A G 7: 25,203,625 V303A probably damaging Het
Dmd G T X: 84,425,738 A2370S probably benign Het
Dnah10 T A 5: 124,808,851 N3009K probably damaging Het
Dnajc13 G T 9: 104,200,509 N934K probably damaging Het
Dock1 C T 7: 134,737,718 L106F probably damaging Het
Fat3 A G 9: 15,997,729 Y2326H probably benign Het
Fhl5 A T 4: 25,207,101 C222* probably null Het
Gm10639 C T 9: 78,302,817 A135V probably benign Het
Gm1840 A G 8: 5,639,888 noncoding transcript Het
Gnmt T C 17: 46,725,928 T252A probably benign Het
Gtf2f1 A G 17: 57,004,307 probably null Het
Gtf3a T C 5: 146,953,229 Y187H probably damaging Het
Hdac2 A G 10: 36,974,792 Y14C probably damaging Het
Hnrnph1 T G 11: 50,385,762 probably benign Het
Homer2 T C 7: 81,618,603 D92G possibly damaging Het
Hspg2 T C 4: 137,550,024 S2885P probably damaging Het
Insr A G 8: 3,161,770 S1084P probably damaging Het
Ints11 T A 4: 155,887,624 V362E probably damaging Het
Kank2 T C 9: 21,779,899 N513S probably damaging Het
Kdelc1 C T 1: 44,110,757 W424* probably null Het
Kl T G 5: 150,953,288 V191G probably damaging Het
Krt23 A G 11: 99,486,698 probably null Het
Lama3 A C 18: 12,450,424 T690P possibly damaging Het
Lamb1 G A 12: 31,282,721 A281T possibly damaging Het
Lck T C 4: 129,555,640 E299G probably damaging Het
Lonrf1 A G 8: 36,222,710 V703A probably damaging Het
Ly6f T C 15: 75,271,677 C78R probably damaging Het
Mapkap1 C T 2: 34,533,781 probably benign Het
Mast1 T A 8: 84,913,089 I1204F probably damaging Het
Mbd6 C T 10: 127,285,873 probably benign Het
Mef2c A T 13: 83,592,901 T60S probably damaging Het
Mgat4c C T 10: 102,389,119 T398I probably damaging Het
Mmp12 C A 9: 7,350,016 H102Q probably damaging Het
Mmp20 G A 9: 7,645,373 G308E probably damaging Het
Mms19 A T 19: 41,954,846 L395Q probably damaging Het
Mus81 A G 19: 5,487,931 probably benign Het
Mypn C T 10: 63,193,203 R27H probably benign Het
Nav3 T C 10: 109,853,300 E372G probably damaging Het
Ncoa1 T A 12: 4,339,105 I57F probably damaging Het
Ncstn T C 1: 172,082,592 probably benign Het
Nefm C T 14: 68,124,159 D219N probably damaging Het
Notch2 C T 3: 98,146,537 T2172I possibly damaging Het
Obscn T A 11: 59,133,946 K423* probably null Het
Olfr1164 A C 2: 88,093,628 S103A probably benign Het
Olfr173 T C 16: 58,797,321 N175S probably benign Het
Olfr459 A T 6: 41,772,264 C12S probably benign Het
Olfr606 A G 7: 103,451,628 N97S probably benign Het
Ostm1 T A 10: 42,696,347 M242K probably damaging Het
Oxnad1 T A 14: 32,099,480 I154N probably damaging Het
Pcdhb10 T A 18: 37,413,099 D409E probably damaging Het
Pdcd11 T C 19: 47,125,037 probably benign Het
Peak1 C A 9: 56,258,632 V671L probably benign Het
Pex1 G A 5: 3,606,444 probably null Het
Plk4 T A 3: 40,805,640 F324I probably benign Het
Ppfibp1 C A 6: 147,019,031 probably null Het
Prcp T A 7: 92,919,082 W276R probably damaging Het
Prr14l T C 5: 32,829,880 E757G probably benign Het
Prss52 T A 14: 64,113,644 Y293N probably damaging Het
Prune2 A G 19: 17,006,792 probably benign Het
Ptprk G C 10: 28,585,947 A84P probably damaging Het
Ptprk C T 10: 28,585,948 A84V probably damaging Het
Rock1 A G 18: 10,079,120 L1116P possibly damaging Het
Sdha A T 13: 74,327,333 F526Y probably benign Het
Sema4b T C 7: 80,220,206 F414S probably damaging Het
Serpina12 T C 12: 104,035,701 D252G probably damaging Het
Siglecg C T 7: 43,411,126 A310V probably benign Het
Slc30a8 A G 15: 52,325,570 I194V probably benign Het
Spred3 A G 7: 29,162,975 S148P probably damaging Het
Taf9b A G X: 106,218,408 S58P probably damaging Het
Tgm4 A T 9: 123,062,419 Y109F probably benign Het
Tmprss11c T G 5: 86,237,609 probably benign Het
Tmtc3 A T 10: 100,471,404 V246D probably damaging Het
Tnip1 C T 11: 54,937,994 G116R probably damaging Het
Tpr A G 1: 150,428,241 E1455G possibly damaging Het
Ttc3 T A 16: 94,432,004 L986* probably null Het
Txndc15 A G 13: 55,724,623 I275V possibly damaging Het
Ugt2b1 T A 5: 86,926,456 I15L probably benign Het
Upf2 T C 2: 5,957,634 V49A possibly damaging Het
Vmn1r117 G A 7: 20,883,446 P226S probably benign Het
Vmn2r28 A T 7: 5,490,457 H163Q probably benign Het
Vstm2a T A 11: 16,263,240 S208R probably damaging Het
Zfp346 T A 13: 55,113,097 C79* probably null Het
Zfp628 A T 7: 4,921,616 T946S probably benign Het
Other mutations in Catsperg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Catsperg2 APN 7 29705404 missense possibly damaging 0.86
IGL00095:Catsperg2 APN 7 29698058 missense possibly damaging 0.73
IGL00902:Catsperg2 APN 7 29701143 missense possibly damaging 0.93
IGL01667:Catsperg2 APN 7 29710133 missense probably damaging 0.98
IGL01791:Catsperg2 APN 7 29704665 splice site probably null
IGL01961:Catsperg2 APN 7 29721672 splice site probably benign
IGL02187:Catsperg2 APN 7 29721366 missense probably benign 0.02
IGL02605:Catsperg2 APN 7 29719565 missense possibly damaging 0.71
IGL03001:Catsperg2 APN 7 29725079 missense probably benign 0.32
IGL03228:Catsperg2 APN 7 29698225 missense probably damaging 0.96
IGL03239:Catsperg2 APN 7 29697716 missense probably benign 0.04
IGL03242:Catsperg2 APN 7 29725479 unclassified probably benign
IGL03247:Catsperg2 APN 7 29717048 missense possibly damaging 0.71
IGL03256:Catsperg2 APN 7 29709874 missense probably damaging 0.99
PIT4520001:Catsperg2 UTSW 7 29710161 missense possibly damaging 0.93
R0052:Catsperg2 UTSW 7 29725020 splice site probably benign
R0281:Catsperg2 UTSW 7 29706571 missense possibly damaging 0.86
R0357:Catsperg2 UTSW 7 29714901 missense possibly damaging 0.93
R0578:Catsperg2 UTSW 7 29704691 missense possibly damaging 0.71
R0732:Catsperg2 UTSW 7 29700696 missense probably damaging 1.00
R0826:Catsperg2 UTSW 7 29705624 missense possibly damaging 0.92
R1535:Catsperg2 UTSW 7 29698246 missense possibly damaging 0.85
R1925:Catsperg2 UTSW 7 29697764 missense probably benign 0.01
R1990:Catsperg2 UTSW 7 29721045 nonsense probably null
R3433:Catsperg2 UTSW 7 29701218 missense possibly damaging 0.71
R3721:Catsperg2 UTSW 7 29705102 missense probably benign 0.02
R4020:Catsperg2 UTSW 7 29717004 missense probably damaging 0.99
R4760:Catsperg2 UTSW 7 29705635 missense probably damaging 0.99
R4829:Catsperg2 UTSW 7 29701125 missense probably damaging 0.98
R5033:Catsperg2 UTSW 7 29710134 missense possibly damaging 0.93
R5093:Catsperg2 UTSW 7 29716998 missense probably benign 0.32
R5266:Catsperg2 UTSW 7 29717066 missense probably damaging 0.98
R5267:Catsperg2 UTSW 7 29717066 missense probably damaging 0.98
R5287:Catsperg2 UTSW 7 29697838 missense possibly damaging 0.96
R5427:Catsperg2 UTSW 7 29714850 missense possibly damaging 0.71
R5575:Catsperg2 UTSW 7 29705590 missense possibly damaging 0.84
R5685:Catsperg2 UTSW 7 29701188 missense probably damaging 1.00
R5844:Catsperg2 UTSW 7 29697832 missense possibly damaging 0.96
R5982:Catsperg2 UTSW 7 29713017 missense possibly damaging 0.51
R6662:Catsperg2 UTSW 7 29719513 start gained probably benign
R6744:Catsperg2 UTSW 7 29709819 missense probably benign 0.23
R7171:Catsperg2 UTSW 7 29705325 missense possibly damaging 0.71
R7239:Catsperg2 UTSW 7 29710082 missense probably benign 0.00
R7336:Catsperg2 UTSW 7 29706601 missense possibly damaging 0.83
R7498:Catsperg2 UTSW 7 29717102 missense possibly damaging 0.71
R7548:Catsperg2 UTSW 7 29709826 missense probably benign 0.32
R7562:Catsperg2 UTSW 7 29697719 missense probably benign 0.18
R7565:Catsperg2 UTSW 7 29712981 missense probably null 0.71
R7600:Catsperg2 UTSW 7 29704858 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- AGTTGGCAGCCCTCACCTCATATC -3'
(R):5'- TGGGCTTCTGGCAGTCTCCTAATAC -3'

Sequencing Primer
(F):5'- CCTCATATCCTATGGCGAATAAGG -3'
(R):5'- TGGCAGTCTCCTAATACCTCTC -3'
Posted On2013-05-23