Incidental Mutation 'R0480:Catsperg2'
ID 41925
Institutional Source Beutler Lab
Gene Symbol Catsperg2
Ensembl Gene ENSMUSG00000049123
Gene Name cation channel sperm associated auxiliary subunit gamma 2
Synonyms CATSPERG, 1700067C01Rik
MMRRC Submission 038680-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R0480 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 29396644-29426457 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 29420723 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Histidine at position 190 (N190H)
Ref Sequence ENSEMBL: ENSMUSP00000147099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061193] [ENSMUST00000207115] [ENSMUST00000208607] [ENSMUST00000209126] [ENSMUST00000208371]
AlphaFold C6KI89
Predicted Effect probably damaging
Transcript: ENSMUST00000061193
AA Change: N190H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052285
Gene: ENSMUSG00000049123
AA Change: N190H

DomainStartEndE-ValueType
Pfam:CATSPERG 2 973 N/A PFAM
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1106 1118 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207115
AA Change: N70H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208345
Predicted Effect probably damaging
Transcript: ENSMUST00000208607
AA Change: N190H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000209126
AA Change: N190H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000208371
Meta Mutation Damage Score 0.1522 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 99% (117/118)
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,771,012 (GRCm39) L165F probably damaging Het
Adamts18 A G 8: 114,465,450 (GRCm39) V714A possibly damaging Het
Adamtsl1 G T 4: 86,171,055 (GRCm39) A518S probably benign Het
Adcy2 C T 13: 68,880,231 (GRCm39) V363M probably damaging Het
Ago4 G T 4: 126,419,870 (GRCm39) Q36K probably benign Het
Akr1a1 A G 4: 116,497,044 (GRCm39) V172A possibly damaging Het
Alkbh2 T A 5: 114,263,596 (GRCm39) N137I probably damaging Het
Ank3 T A 10: 69,715,756 (GRCm39) S470T probably damaging Het
Ankrd12 T C 17: 66,356,823 (GRCm39) T65A possibly damaging Het
Aox1 A T 1: 58,082,810 (GRCm39) probably benign Het
Arhgap11a A T 2: 113,670,163 (GRCm39) I320N probably benign Het
Arhgap17 G A 7: 122,893,867 (GRCm39) H518Y probably damaging Het
Ascc3 T C 10: 50,611,348 (GRCm39) V1563A probably damaging Het
Atf2 G A 2: 73,649,500 (GRCm39) probably benign Het
Bmpr2 C T 1: 59,884,818 (GRCm39) T268I probably damaging Het
Bpifb9a A G 2: 154,106,608 (GRCm39) I380V probably benign Het
C2cd2 G A 16: 97,678,348 (GRCm39) T363I probably benign Het
Ccdc138 T C 10: 58,397,789 (GRCm39) L543S probably damaging Het
Ccdc170 A T 10: 4,468,939 (GRCm39) K162N probably benign Het
Cdca5 G T 19: 6,140,328 (GRCm39) R163L probably damaging Het
Cdh24 A G 14: 54,870,054 (GRCm39) F239S probably benign Het
Cdkl3 T C 11: 51,895,882 (GRCm39) V43A probably damaging Het
Cep152 G T 2: 125,423,639 (GRCm39) Q921K possibly damaging Het
Cftr G A 6: 18,274,517 (GRCm39) probably benign Het
Chmp5 T C 4: 40,948,690 (GRCm39) probably benign Het
Cit T A 5: 116,071,452 (GRCm39) probably benign Het
Cngb3 T A 4: 19,309,517 (GRCm39) probably benign Het
Cnr2 A G 4: 135,644,912 (GRCm39) E330G probably benign Het
Cyp21a1 A T 17: 35,020,800 (GRCm39) L473Q probably damaging Het
Dchs1 T C 7: 105,420,696 (GRCm39) T575A probably benign Het
Dedd2 A G 7: 24,903,050 (GRCm39) V303A probably damaging Het
Dmd G T X: 83,469,344 (GRCm39) A2370S probably benign Het
Dnah10 T A 5: 124,885,915 (GRCm39) N3009K probably damaging Het
Dnajc13 G T 9: 104,077,708 (GRCm39) N934K probably damaging Het
Dock1 C T 7: 134,339,447 (GRCm39) L106F probably damaging Het
Fat3 A G 9: 15,909,025 (GRCm39) Y2326H probably benign Het
Fhl5 A T 4: 25,207,101 (GRCm39) C222* probably null Het
Gnmt T C 17: 47,036,854 (GRCm39) T252A probably benign Het
Gpi-ps A G 8: 5,689,888 (GRCm39) noncoding transcript Het
Gsta5 C T 9: 78,210,099 (GRCm39) A135V probably benign Het
Gtf2f1 A G 17: 57,311,307 (GRCm39) probably null Het
Gtf3a T C 5: 146,890,039 (GRCm39) Y187H probably damaging Het
Hdac2 A G 10: 36,850,788 (GRCm39) Y14C probably damaging Het
Hnrnph1 T G 11: 50,276,589 (GRCm39) probably benign Het
Homer2 T C 7: 81,268,351 (GRCm39) D92G possibly damaging Het
Hspg2 T C 4: 137,277,335 (GRCm39) S2885P probably damaging Het
Insr A G 8: 3,211,770 (GRCm39) S1084P probably damaging Het
Ints11 T A 4: 155,972,081 (GRCm39) V362E probably damaging Het
Kank2 T C 9: 21,691,195 (GRCm39) N513S probably damaging Het
Kl T G 5: 150,876,753 (GRCm39) V191G probably damaging Het
Krt23 A G 11: 99,377,524 (GRCm39) probably null Het
Lama3 A C 18: 12,583,481 (GRCm39) T690P possibly damaging Het
Lamb1 G A 12: 31,332,720 (GRCm39) A281T possibly damaging Het
Lck T C 4: 129,449,433 (GRCm39) E299G probably damaging Het
Lonrf1 A G 8: 36,689,864 (GRCm39) V703A probably damaging Het
Ly6f T C 15: 75,143,526 (GRCm39) C78R probably damaging Het
Mapkap1 C T 2: 34,423,793 (GRCm39) probably benign Het
Mast1 T A 8: 85,639,718 (GRCm39) I1204F probably damaging Het
Mbd6 C T 10: 127,121,742 (GRCm39) probably benign Het
Mef2c A T 13: 83,741,020 (GRCm39) T60S probably damaging Het
Mgat4c C T 10: 102,224,980 (GRCm39) T398I probably damaging Het
Mmp12 C A 9: 7,350,016 (GRCm39) H102Q probably damaging Het
Mmp20 G A 9: 7,645,374 (GRCm39) G308E probably damaging Het
Mms19 A T 19: 41,943,285 (GRCm39) L395Q probably damaging Het
Mus81 A G 19: 5,537,959 (GRCm39) probably benign Het
Mypn C T 10: 63,028,982 (GRCm39) R27H probably benign Het
Nav3 T C 10: 109,689,161 (GRCm39) E372G probably damaging Het
Ncoa1 T A 12: 4,389,105 (GRCm39) I57F probably damaging Het
Ncstn T C 1: 171,910,159 (GRCm39) probably benign Het
Nefm C T 14: 68,361,608 (GRCm39) D219N probably damaging Het
Notch2 C T 3: 98,053,853 (GRCm39) T2172I possibly damaging Het
Obscn T A 11: 59,024,772 (GRCm39) K423* probably null Het
Or51l14 A G 7: 103,100,835 (GRCm39) N97S probably benign Het
Or5d37 A C 2: 87,923,972 (GRCm39) S103A probably benign Het
Or5k1 T C 16: 58,617,684 (GRCm39) N175S probably benign Het
Or9a2 A T 6: 41,749,198 (GRCm39) C12S probably benign Het
Ostm1 T A 10: 42,572,343 (GRCm39) M242K probably damaging Het
Oxnad1 T A 14: 31,821,437 (GRCm39) I154N probably damaging Het
Pcdhb10 T A 18: 37,546,152 (GRCm39) D409E probably damaging Het
Pdcd11 T C 19: 47,113,476 (GRCm39) probably benign Het
Peak1 C A 9: 56,165,916 (GRCm39) V671L probably benign Het
Pex1 G A 5: 3,656,444 (GRCm39) probably null Het
Plk4 T A 3: 40,760,075 (GRCm39) F324I probably benign Het
Poglut2 C T 1: 44,149,917 (GRCm39) W424* probably null Het
Ppfibp1 C A 6: 146,920,529 (GRCm39) probably null Het
Prcp T A 7: 92,568,290 (GRCm39) W276R probably damaging Het
Prr14l T C 5: 32,987,224 (GRCm39) E757G probably benign Het
Prss52 T A 14: 64,351,093 (GRCm39) Y293N probably damaging Het
Prune2 A G 19: 16,984,156 (GRCm39) probably benign Het
Ptprk G C 10: 28,461,943 (GRCm39) A84P probably damaging Het
Ptprk C T 10: 28,461,944 (GRCm39) A84V probably damaging Het
Rock1 A G 18: 10,079,120 (GRCm39) L1116P possibly damaging Het
Sdha A T 13: 74,475,452 (GRCm39) F526Y probably benign Het
Sema4b T C 7: 79,869,954 (GRCm39) F414S probably damaging Het
Serpina12 T C 12: 104,001,960 (GRCm39) D252G probably damaging Het
Siglecg C T 7: 43,060,550 (GRCm39) A310V probably benign Het
Slc30a8 A G 15: 52,188,966 (GRCm39) I194V probably benign Het
Spred3 A G 7: 28,862,400 (GRCm39) S148P probably damaging Het
Taf9b A G X: 105,262,014 (GRCm39) S58P probably damaging Het
Tgm4 A T 9: 122,891,484 (GRCm39) Y109F probably benign Het
Tmprss11c T G 5: 86,385,468 (GRCm39) probably benign Het
Tmtc3 A T 10: 100,307,266 (GRCm39) V246D probably damaging Het
Tnip1 C T 11: 54,828,820 (GRCm39) G116R probably damaging Het
Tpr A G 1: 150,303,992 (GRCm39) E1455G possibly damaging Het
Ttc3 T A 16: 94,232,863 (GRCm39) L986* probably null Het
Txndc15 A G 13: 55,872,436 (GRCm39) I275V possibly damaging Het
Ugt2b1 T A 5: 87,074,315 (GRCm39) I15L probably benign Het
Upf2 T C 2: 5,962,445 (GRCm39) V49A possibly damaging Het
Vmn1r117 G A 7: 20,617,371 (GRCm39) P226S probably benign Het
Vmn2r28 A T 7: 5,493,456 (GRCm39) H163Q probably benign Het
Vstm2a T A 11: 16,213,240 (GRCm39) S208R probably damaging Het
Zfp346 T A 13: 55,260,910 (GRCm39) C79* probably null Het
Zfp628 A T 7: 4,924,615 (GRCm39) T946S probably benign Het
Other mutations in Catsperg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Catsperg2 APN 7 29,404,829 (GRCm39) missense possibly damaging 0.86
IGL00095:Catsperg2 APN 7 29,397,483 (GRCm39) missense possibly damaging 0.73
IGL00902:Catsperg2 APN 7 29,400,568 (GRCm39) missense possibly damaging 0.93
IGL01667:Catsperg2 APN 7 29,409,558 (GRCm39) missense probably damaging 0.98
IGL01791:Catsperg2 APN 7 29,404,090 (GRCm39) splice site probably null
IGL01961:Catsperg2 APN 7 29,421,097 (GRCm39) splice site probably benign
IGL02187:Catsperg2 APN 7 29,420,791 (GRCm39) missense probably benign 0.02
IGL02605:Catsperg2 APN 7 29,418,990 (GRCm39) missense possibly damaging 0.71
IGL03001:Catsperg2 APN 7 29,424,504 (GRCm39) missense probably benign 0.32
IGL03228:Catsperg2 APN 7 29,397,650 (GRCm39) missense probably damaging 0.96
IGL03239:Catsperg2 APN 7 29,397,141 (GRCm39) missense probably benign 0.04
IGL03242:Catsperg2 APN 7 29,424,904 (GRCm39) unclassified probably benign
IGL03247:Catsperg2 APN 7 29,416,473 (GRCm39) missense possibly damaging 0.71
IGL03256:Catsperg2 APN 7 29,409,299 (GRCm39) missense probably damaging 0.99
PIT4520001:Catsperg2 UTSW 7 29,409,586 (GRCm39) missense possibly damaging 0.93
R0052:Catsperg2 UTSW 7 29,424,445 (GRCm39) splice site probably benign
R0281:Catsperg2 UTSW 7 29,405,996 (GRCm39) missense possibly damaging 0.86
R0357:Catsperg2 UTSW 7 29,414,326 (GRCm39) missense possibly damaging 0.93
R0578:Catsperg2 UTSW 7 29,404,116 (GRCm39) missense possibly damaging 0.71
R0732:Catsperg2 UTSW 7 29,400,121 (GRCm39) missense probably damaging 1.00
R0826:Catsperg2 UTSW 7 29,405,049 (GRCm39) missense possibly damaging 0.92
R1535:Catsperg2 UTSW 7 29,397,671 (GRCm39) missense possibly damaging 0.85
R1925:Catsperg2 UTSW 7 29,397,189 (GRCm39) missense probably benign 0.01
R1990:Catsperg2 UTSW 7 29,420,470 (GRCm39) nonsense probably null
R3433:Catsperg2 UTSW 7 29,400,643 (GRCm39) missense possibly damaging 0.71
R3721:Catsperg2 UTSW 7 29,404,527 (GRCm39) missense probably benign 0.02
R4020:Catsperg2 UTSW 7 29,416,429 (GRCm39) missense probably damaging 0.99
R4760:Catsperg2 UTSW 7 29,405,060 (GRCm39) missense probably damaging 0.99
R4829:Catsperg2 UTSW 7 29,400,550 (GRCm39) missense probably damaging 0.98
R5033:Catsperg2 UTSW 7 29,409,559 (GRCm39) missense possibly damaging 0.93
R5093:Catsperg2 UTSW 7 29,416,423 (GRCm39) missense probably benign 0.32
R5266:Catsperg2 UTSW 7 29,416,491 (GRCm39) missense probably damaging 0.98
R5267:Catsperg2 UTSW 7 29,416,491 (GRCm39) missense probably damaging 0.98
R5287:Catsperg2 UTSW 7 29,397,263 (GRCm39) missense possibly damaging 0.96
R5427:Catsperg2 UTSW 7 29,414,275 (GRCm39) missense possibly damaging 0.71
R5575:Catsperg2 UTSW 7 29,405,015 (GRCm39) missense possibly damaging 0.84
R5685:Catsperg2 UTSW 7 29,400,613 (GRCm39) missense probably damaging 1.00
R5844:Catsperg2 UTSW 7 29,397,257 (GRCm39) missense possibly damaging 0.96
R5982:Catsperg2 UTSW 7 29,412,442 (GRCm39) missense possibly damaging 0.51
R6662:Catsperg2 UTSW 7 29,418,938 (GRCm39) start gained probably benign
R6744:Catsperg2 UTSW 7 29,409,244 (GRCm39) missense probably benign 0.23
R7171:Catsperg2 UTSW 7 29,404,750 (GRCm39) missense possibly damaging 0.71
R7239:Catsperg2 UTSW 7 29,409,507 (GRCm39) missense probably benign 0.00
R7336:Catsperg2 UTSW 7 29,406,026 (GRCm39) missense possibly damaging 0.83
R7498:Catsperg2 UTSW 7 29,416,527 (GRCm39) missense possibly damaging 0.71
R7548:Catsperg2 UTSW 7 29,409,251 (GRCm39) missense probably benign 0.32
R7562:Catsperg2 UTSW 7 29,397,144 (GRCm39) missense probably benign 0.18
R7565:Catsperg2 UTSW 7 29,412,406 (GRCm39) missense probably null 0.71
R7600:Catsperg2 UTSW 7 29,404,283 (GRCm39) missense probably benign 0.32
R8460:Catsperg2 UTSW 7 29,404,744 (GRCm39) missense possibly damaging 0.92
R8461:Catsperg2 UTSW 7 29,404,744 (GRCm39) missense possibly damaging 0.92
R8751:Catsperg2 UTSW 7 29,404,744 (GRCm39) missense possibly damaging 0.92
R8752:Catsperg2 UTSW 7 29,404,744 (GRCm39) missense possibly damaging 0.92
R8829:Catsperg2 UTSW 7 29,397,269 (GRCm39) missense probably benign 0.33
R8832:Catsperg2 UTSW 7 29,397,269 (GRCm39) missense probably benign 0.33
R9264:Catsperg2 UTSW 7 29,397,613 (GRCm39) missense possibly damaging 0.72
R9284:Catsperg2 UTSW 7 29,405,006 (GRCm39) critical splice donor site probably null
R9468:Catsperg2 UTSW 7 29,409,432 (GRCm39) critical splice donor site probably null
Z1177:Catsperg2 UTSW 7 29,397,207 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTTGGCAGCCCTCACCTCATATC -3'
(R):5'- TGGGCTTCTGGCAGTCTCCTAATAC -3'

Sequencing Primer
(F):5'- CCTCATATCCTATGGCGAATAAGG -3'
(R):5'- TGGCAGTCTCCTAATACCTCTC -3'
Posted On 2013-05-23