Incidental Mutation 'R0480:Mef2c'
ID41972
Institutional Source Beutler Lab
Gene Symbol Mef2c
Ensembl Gene ENSMUSG00000005583
Gene Namemyocyte enhancer factor 2C
Synonyms9930028G15Rik, 5430401D19Rik
MMRRC Submission 038680-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0480 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location83504034-83667080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83592901 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 60 (T60S)
Ref Sequence ENSEMBL: ENSMUSP00000143187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005722] [ENSMUST00000163888] [ENSMUST00000185052] [ENSMUST00000195904] [ENSMUST00000195984] [ENSMUST00000196207] [ENSMUST00000196493] [ENSMUST00000196730] [ENSMUST00000197146] [ENSMUST00000197681] [ENSMUST00000197722] [ENSMUST00000197938] [ENSMUST00000198064] [ENSMUST00000198069] [ENSMUST00000198199] [ENSMUST00000199019] [ENSMUST00000200394] [ENSMUST00000199105] [ENSMUST00000199167] [ENSMUST00000199450] [ENSMUST00000198217] [ENSMUST00000199432] [ENSMUST00000199210] [ENSMUST00000200123] [ENSMUST00000198916]
Predicted Effect probably damaging
Transcript: ENSMUST00000005722
AA Change: T60S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005722
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 154 5.3e-27 PFAM
low complexity region 314 324 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163888
AA Change: T60S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132547
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 155 1.4e-17 PFAM
low complexity region 316 326 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000185052
AA Change: T60S

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138826
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 154 6e-27 PFAM
low complexity region 322 332 N/A INTRINSIC
low complexity region 418 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195904
AA Change: T60S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143339
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 156 5.8e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195984
AA Change: T60S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143611
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 155 2.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196207
AA Change: T60S

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143221
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 120 2.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196493
AA Change: T60S

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142897
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000196730
AA Change: T60S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143338
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 154 4.9e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000197146
AA Change: T60S

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143227
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 9.5e-15 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197681
AA Change: T60S

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143420
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 9.5e-15 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197722
AA Change: T60S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142456
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 156 2.8e-12 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 363 374 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197938
AA Change: T60S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143187
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 154 6.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198064
AA Change: T60S

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142399
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000198069
AA Change: T60S

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143286
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000198199
AA Change: T60S

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143742
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 153 2e-23 PFAM
low complexity region 314 324 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199019
AA Change: T60S

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143401
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 1.1e-14 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200394
AA Change: T60S

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143598
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 155 1.6e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199105
AA Change: T60S

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143212
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 1.1e-14 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199167
AA Change: T60S

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142884
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 154 6e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199450
AA Change: T60S

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143315
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 5.1e-15 PFAM
low complexity region 316 326 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000198217
AA Change: T60S

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142487
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
low complexity region 268 278 N/A INTRINSIC
low complexity region 364 380 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199432
AA Change: T60S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142714
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 156 3.1e-12 PFAM
low complexity region 316 326 N/A INTRINSIC
low complexity region 380 396 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199210
AA Change: T60S

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142595
Gene: ENSMUSG00000005583
AA Change: T60S

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
low complexity region 276 286 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199262
Predicted Effect probably benign
Transcript: ENSMUST00000200123
Predicted Effect probably benign
Transcript: ENSMUST00000198916
Meta Mutation Damage Score 0.4757 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 99% (117/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the MADS box transcription enhancer factor 2 (MEF2) family of proteins, which play a role in myogenesis. The encoded protein, MEF2 polypeptide C, has both trans-activating and DNA binding activities. This protein may play a role in maintaining the differentiated state of muscle cells. Mutations and deletions at this locus have been associated with severe mental retardation, stereotypic movements, epilepsy, and cerebral malformation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have cardiovascular abnormalities and die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,880,186 L165F probably damaging Het
Adamts18 A G 8: 113,738,818 V714A possibly damaging Het
Adamtsl1 G T 4: 86,252,818 A518S probably benign Het
Adcy2 C T 13: 68,732,112 V363M probably damaging Het
Ago4 G T 4: 126,526,077 Q36K probably benign Het
Akr1a1 A G 4: 116,639,847 V172A possibly damaging Het
Alkbh2 T A 5: 114,125,535 N137I probably damaging Het
Ank3 T A 10: 69,879,926 S470T probably damaging Het
Ankrd12 T C 17: 66,049,828 T65A possibly damaging Het
Aox1 A T 1: 58,043,651 probably benign Het
Arhgap11a A T 2: 113,839,818 I320N probably benign Het
Arhgap17 G A 7: 123,294,644 H518Y probably damaging Het
Ascc3 T C 10: 50,735,252 V1563A probably damaging Het
Atf2 G A 2: 73,819,156 probably benign Het
Bmpr2 C T 1: 59,845,659 T268I probably damaging Het
Bpifb9a A G 2: 154,264,688 I380V probably benign Het
C2cd2 G A 16: 97,877,148 T363I probably benign Het
Catsperg2 T G 7: 29,721,298 N190H probably damaging Het
Ccdc138 T C 10: 58,561,967 L543S probably damaging Het
Ccdc170 A T 10: 4,518,939 K162N probably benign Het
Cdca5 G T 19: 6,090,298 R163L probably damaging Het
Cdh24 A G 14: 54,632,597 F239S probably benign Het
Cdkl3 T C 11: 52,005,055 V43A probably damaging Het
Cep152 G T 2: 125,581,719 Q921K possibly damaging Het
Cftr G A 6: 18,274,518 probably benign Het
Chmp5 T C 4: 40,948,690 probably benign Het
Cit T A 5: 115,933,393 probably benign Het
Cngb3 T A 4: 19,309,517 probably benign Het
Cnr2 A G 4: 135,917,601 E330G probably benign Het
Cyp21a1 A T 17: 34,801,826 L473Q probably damaging Het
Dchs1 T C 7: 105,771,489 T575A probably benign Het
Dedd2 A G 7: 25,203,625 V303A probably damaging Het
Dmd G T X: 84,425,738 A2370S probably benign Het
Dnah10 T A 5: 124,808,851 N3009K probably damaging Het
Dnajc13 G T 9: 104,200,509 N934K probably damaging Het
Dock1 C T 7: 134,737,718 L106F probably damaging Het
Fat3 A G 9: 15,997,729 Y2326H probably benign Het
Fhl5 A T 4: 25,207,101 C222* probably null Het
Gm10639 C T 9: 78,302,817 A135V probably benign Het
Gm1840 A G 8: 5,639,888 noncoding transcript Het
Gnmt T C 17: 46,725,928 T252A probably benign Het
Gtf2f1 A G 17: 57,004,307 probably null Het
Gtf3a T C 5: 146,953,229 Y187H probably damaging Het
Hdac2 A G 10: 36,974,792 Y14C probably damaging Het
Hnrnph1 T G 11: 50,385,762 probably benign Het
Homer2 T C 7: 81,618,603 D92G possibly damaging Het
Hspg2 T C 4: 137,550,024 S2885P probably damaging Het
Insr A G 8: 3,161,770 S1084P probably damaging Het
Ints11 T A 4: 155,887,624 V362E probably damaging Het
Kank2 T C 9: 21,779,899 N513S probably damaging Het
Kdelc1 C T 1: 44,110,757 W424* probably null Het
Kl T G 5: 150,953,288 V191G probably damaging Het
Krt23 A G 11: 99,486,698 probably null Het
Lama3 A C 18: 12,450,424 T690P possibly damaging Het
Lamb1 G A 12: 31,282,721 A281T possibly damaging Het
Lck T C 4: 129,555,640 E299G probably damaging Het
Lonrf1 A G 8: 36,222,710 V703A probably damaging Het
Ly6f T C 15: 75,271,677 C78R probably damaging Het
Mapkap1 C T 2: 34,533,781 probably benign Het
Mast1 T A 8: 84,913,089 I1204F probably damaging Het
Mbd6 C T 10: 127,285,873 probably benign Het
Mgat4c C T 10: 102,389,119 T398I probably damaging Het
Mmp12 C A 9: 7,350,016 H102Q probably damaging Het
Mmp20 G A 9: 7,645,373 G308E probably damaging Het
Mms19 A T 19: 41,954,846 L395Q probably damaging Het
Mus81 A G 19: 5,487,931 probably benign Het
Mypn C T 10: 63,193,203 R27H probably benign Het
Nav3 T C 10: 109,853,300 E372G probably damaging Het
Ncoa1 T A 12: 4,339,105 I57F probably damaging Het
Ncstn T C 1: 172,082,592 probably benign Het
Nefm C T 14: 68,124,159 D219N probably damaging Het
Notch2 C T 3: 98,146,537 T2172I possibly damaging Het
Obscn T A 11: 59,133,946 K423* probably null Het
Olfr1164 A C 2: 88,093,628 S103A probably benign Het
Olfr173 T C 16: 58,797,321 N175S probably benign Het
Olfr459 A T 6: 41,772,264 C12S probably benign Het
Olfr606 A G 7: 103,451,628 N97S probably benign Het
Ostm1 T A 10: 42,696,347 M242K probably damaging Het
Oxnad1 T A 14: 32,099,480 I154N probably damaging Het
Pcdhb10 T A 18: 37,413,099 D409E probably damaging Het
Pdcd11 T C 19: 47,125,037 probably benign Het
Peak1 C A 9: 56,258,632 V671L probably benign Het
Pex1 G A 5: 3,606,444 probably null Het
Plk4 T A 3: 40,805,640 F324I probably benign Het
Ppfibp1 C A 6: 147,019,031 probably null Het
Prcp T A 7: 92,919,082 W276R probably damaging Het
Prr14l T C 5: 32,829,880 E757G probably benign Het
Prss52 T A 14: 64,113,644 Y293N probably damaging Het
Prune2 A G 19: 17,006,792 probably benign Het
Ptprk G C 10: 28,585,947 A84P probably damaging Het
Ptprk C T 10: 28,585,948 A84V probably damaging Het
Rock1 A G 18: 10,079,120 L1116P possibly damaging Het
Sdha A T 13: 74,327,333 F526Y probably benign Het
Sema4b T C 7: 80,220,206 F414S probably damaging Het
Serpina12 T C 12: 104,035,701 D252G probably damaging Het
Siglecg C T 7: 43,411,126 A310V probably benign Het
Slc30a8 A G 15: 52,325,570 I194V probably benign Het
Spred3 A G 7: 29,162,975 S148P probably damaging Het
Taf9b A G X: 106,218,408 S58P probably damaging Het
Tgm4 A T 9: 123,062,419 Y109F probably benign Het
Tmprss11c T G 5: 86,237,609 probably benign Het
Tmtc3 A T 10: 100,471,404 V246D probably damaging Het
Tnip1 C T 11: 54,937,994 G116R probably damaging Het
Tpr A G 1: 150,428,241 E1455G possibly damaging Het
Ttc3 T A 16: 94,432,004 L986* probably null Het
Txndc15 A G 13: 55,724,623 I275V possibly damaging Het
Ugt2b1 T A 5: 86,926,456 I15L probably benign Het
Upf2 T C 2: 5,957,634 V49A possibly damaging Het
Vmn1r117 G A 7: 20,883,446 P226S probably benign Het
Vmn2r28 A T 7: 5,490,457 H163Q probably benign Het
Vstm2a T A 11: 16,263,240 S208R probably damaging Het
Zfp346 T A 13: 55,113,097 C79* probably null Het
Zfp628 A T 7: 4,921,616 T946S probably benign Het
Other mutations in Mef2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Mef2c APN 13 83625380 missense probably damaging 1.00
IGL01012:Mef2c APN 13 83655595 missense probably damaging 1.00
IGL03131:Mef2c APN 13 83662375 missense probably damaging 1.00
IGL03186:Mef2c APN 13 83652868 missense probably benign 0.03
LCD18:Mef2c UTSW 13 83605823 intron probably benign
R0021:Mef2c UTSW 13 83656240 missense probably damaging 1.00
R0062:Mef2c UTSW 13 83652873 missense possibly damaging 0.65
R0755:Mef2c UTSW 13 83656353 critical splice donor site probably null
R1290:Mef2c UTSW 13 83662359 missense probably benign 0.19
R4085:Mef2c UTSW 13 83575702 missense probably damaging 0.98
R4734:Mef2c UTSW 13 83662629 makesense probably null
R5230:Mef2c UTSW 13 83652907 missense possibly damaging 0.89
R5385:Mef2c UTSW 13 83662413 missense probably benign 0.19
R6032:Mef2c UTSW 13 83662359 missense probably benign 0.19
R6032:Mef2c UTSW 13 83662359 missense probably benign 0.19
R6258:Mef2c UTSW 13 83652938 missense probably damaging 1.00
R6670:Mef2c UTSW 13 83662597 missense probably damaging 1.00
R6672:Mef2c UTSW 13 83652856 missense probably damaging 1.00
R6702:Mef2c UTSW 13 83625406 missense possibly damaging 0.70
R6703:Mef2c UTSW 13 83625406 missense possibly damaging 0.70
R6881:Mef2c UTSW 13 83592942 missense probably damaging 1.00
R6907:Mef2c UTSW 13 83654611 missense probably benign 0.32
R7503:Mef2c UTSW 13 83662504 missense possibly damaging 0.80
R8168:Mef2c UTSW 13 83656350 missense probably damaging 0.99
R8438:Mef2c UTSW 13 83656217 missense probably damaging 0.99
Z1177:Mef2c UTSW 13 83625266 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGACTCTGGCAGCTCTACACCATTG -3'
(R):5'- TGCAGCCATAGATGGGGTAAACGC -3'

Sequencing Primer
(F):5'- GTAGTGTGAATACATACGCCAC -3'
(R):5'- GGGGTAAACGCCCCAAG -3'
Posted On2013-05-23