Incidental Mutation 'R0480:Ttc3'
ID41980
Institutional Source Beutler Lab
Gene Symbol Ttc3
Ensembl Gene ENSMUSG00000040785
Gene Nametetratricopeptide repeat domain 3
Synonyms2610202A04Rik, D16Ium21, D16Ium21e, TPRD
MMRRC Submission 038680-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.758) question?
Stock #R0480 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location94370618-94469343 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 94432004 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 986 (L986*)
Ref Sequence ENSEMBL: ENSMUSP00000156151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117648] [ENSMUST00000122895] [ENSMUST00000143145] [ENSMUST00000147046] [ENSMUST00000147352] [ENSMUST00000150346] [ENSMUST00000151770] [ENSMUST00000152117] [ENSMUST00000153988] [ENSMUST00000155692] [ENSMUST00000231569] [ENSMUST00000232660] [ENSMUST00000231850] [ENSMUST00000232395] [ENSMUST00000231915]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101881
Predicted Effect probably null
Transcript: ENSMUST00000117648
AA Change: L986*
SMART Domains Protein: ENSMUSP00000112801
Gene: ENSMUSG00000040785
AA Change: L986*

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 2e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1170 1190 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
low complexity region 1278 1291 N/A INTRINSIC
coiled coil region 1472 1570 N/A INTRINSIC
low complexity region 1876 1887 N/A INTRINSIC
RING 1931 1970 7e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122895
AA Change: L968*
SMART Domains Protein: ENSMUSP00000123037
Gene: ENSMUSG00000040785
AA Change: L968*

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141176
AA Change: L184*
SMART Domains Protein: ENSMUSP00000114483
Gene: ENSMUSG00000040785
AA Change: L184*

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
coiled coil region 72 103 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143145
Predicted Effect probably benign
Transcript: ENSMUST00000147046
SMART Domains Protein: ENSMUSP00000119265
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Pfam:TPR_1 175 206 5.3e-6 PFAM
low complexity region 319 331 N/A INTRINSIC
low complexity region 359 382 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000147352
AA Change: L968*
SMART Domains Protein: ENSMUSP00000116097
Gene: ENSMUSG00000040785
AA Change: L968*

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150346
AA Change: L585*
SMART Domains Protein: ENSMUSP00000122726
Gene: ENSMUSG00000040785
AA Change: L585*

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Pfam:TPR_1 175 206 9.6e-6 PFAM
low complexity region 319 331 N/A INTRINSIC
coiled coil region 364 395 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000151770
AA Change: L986*
SMART Domains Protein: ENSMUSP00000121349
Gene: ENSMUSG00000040785
AA Change: L986*

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 3e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000152117
AA Change: L585*
SMART Domains Protein: ENSMUSP00000116896
Gene: ENSMUSG00000040785
AA Change: L585*

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
SCOP:d1ihga1 69 201 6e-8 SMART
Blast:TPR 175 208 1e-14 BLAST
low complexity region 319 331 N/A INTRINSIC
coiled coil region 364 395 N/A INTRINSIC
low complexity region 617 631 N/A INTRINSIC
low complexity region 635 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153988
SMART Domains Protein: ENSMUSP00000118763
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Blast:TPR 1 22 3e-6 BLAST
low complexity region 134 149 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000155692
AA Change: L1005*
SMART Domains Protein: ENSMUSP00000122724
Gene: ENSMUSG00000040785
AA Change: L1005*

DomainStartEndE-ValueType
TPR 250 283 3.61e-2 SMART
TPR 284 317 3.32e-1 SMART
Blast:TPR 319 351 3e-12 BLAST
low complexity region 463 478 N/A INTRINSIC
TPR 595 628 2.55e-2 SMART
low complexity region 739 751 N/A INTRINSIC
coiled coil region 784 815 N/A INTRINSIC
low complexity region 1037 1051 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000231569
AA Change: L631*
Predicted Effect probably null
Transcript: ENSMUST00000232660
AA Change: L986*
Predicted Effect probably benign
Transcript: ENSMUST00000231850
Predicted Effect probably null
Transcript: ENSMUST00000232395
AA Change: L986*
Predicted Effect probably benign
Transcript: ENSMUST00000231915
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 99% (117/118)
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,880,186 L165F probably damaging Het
Adamts18 A G 8: 113,738,818 V714A possibly damaging Het
Adamtsl1 G T 4: 86,252,818 A518S probably benign Het
Adcy2 C T 13: 68,732,112 V363M probably damaging Het
Ago4 G T 4: 126,526,077 Q36K probably benign Het
Akr1a1 A G 4: 116,639,847 V172A possibly damaging Het
Alkbh2 T A 5: 114,125,535 N137I probably damaging Het
Ank3 T A 10: 69,879,926 S470T probably damaging Het
Ankrd12 T C 17: 66,049,828 T65A possibly damaging Het
Aox1 A T 1: 58,043,651 probably benign Het
Arhgap11a A T 2: 113,839,818 I320N probably benign Het
Arhgap17 G A 7: 123,294,644 H518Y probably damaging Het
Ascc3 T C 10: 50,735,252 V1563A probably damaging Het
Atf2 G A 2: 73,819,156 probably benign Het
Bmpr2 C T 1: 59,845,659 T268I probably damaging Het
Bpifb9a A G 2: 154,264,688 I380V probably benign Het
C2cd2 G A 16: 97,877,148 T363I probably benign Het
Catsperg2 T G 7: 29,721,298 N190H probably damaging Het
Ccdc138 T C 10: 58,561,967 L543S probably damaging Het
Ccdc170 A T 10: 4,518,939 K162N probably benign Het
Cdca5 G T 19: 6,090,298 R163L probably damaging Het
Cdh24 A G 14: 54,632,597 F239S probably benign Het
Cdkl3 T C 11: 52,005,055 V43A probably damaging Het
Cep152 G T 2: 125,581,719 Q921K possibly damaging Het
Cftr G A 6: 18,274,518 probably benign Het
Chmp5 T C 4: 40,948,690 probably benign Het
Cit T A 5: 115,933,393 probably benign Het
Cngb3 T A 4: 19,309,517 probably benign Het
Cnr2 A G 4: 135,917,601 E330G probably benign Het
Cyp21a1 A T 17: 34,801,826 L473Q probably damaging Het
Dchs1 T C 7: 105,771,489 T575A probably benign Het
Dedd2 A G 7: 25,203,625 V303A probably damaging Het
Dmd G T X: 84,425,738 A2370S probably benign Het
Dnah10 T A 5: 124,808,851 N3009K probably damaging Het
Dnajc13 G T 9: 104,200,509 N934K probably damaging Het
Dock1 C T 7: 134,737,718 L106F probably damaging Het
Fat3 A G 9: 15,997,729 Y2326H probably benign Het
Fhl5 A T 4: 25,207,101 C222* probably null Het
Gm10639 C T 9: 78,302,817 A135V probably benign Het
Gm1840 A G 8: 5,639,888 noncoding transcript Het
Gnmt T C 17: 46,725,928 T252A probably benign Het
Gtf2f1 A G 17: 57,004,307 probably null Het
Gtf3a T C 5: 146,953,229 Y187H probably damaging Het
Hdac2 A G 10: 36,974,792 Y14C probably damaging Het
Hnrnph1 T G 11: 50,385,762 probably benign Het
Homer2 T C 7: 81,618,603 D92G possibly damaging Het
Hspg2 T C 4: 137,550,024 S2885P probably damaging Het
Insr A G 8: 3,161,770 S1084P probably damaging Het
Ints11 T A 4: 155,887,624 V362E probably damaging Het
Kank2 T C 9: 21,779,899 N513S probably damaging Het
Kdelc1 C T 1: 44,110,757 W424* probably null Het
Kl T G 5: 150,953,288 V191G probably damaging Het
Krt23 A G 11: 99,486,698 probably null Het
Lama3 A C 18: 12,450,424 T690P possibly damaging Het
Lamb1 G A 12: 31,282,721 A281T possibly damaging Het
Lck T C 4: 129,555,640 E299G probably damaging Het
Lonrf1 A G 8: 36,222,710 V703A probably damaging Het
Ly6f T C 15: 75,271,677 C78R probably damaging Het
Mapkap1 C T 2: 34,533,781 probably benign Het
Mast1 T A 8: 84,913,089 I1204F probably damaging Het
Mbd6 C T 10: 127,285,873 probably benign Het
Mef2c A T 13: 83,592,901 T60S probably damaging Het
Mgat4c C T 10: 102,389,119 T398I probably damaging Het
Mmp12 C A 9: 7,350,016 H102Q probably damaging Het
Mmp20 G A 9: 7,645,373 G308E probably damaging Het
Mms19 A T 19: 41,954,846 L395Q probably damaging Het
Mus81 A G 19: 5,487,931 probably benign Het
Mypn C T 10: 63,193,203 R27H probably benign Het
Nav3 T C 10: 109,853,300 E372G probably damaging Het
Ncoa1 T A 12: 4,339,105 I57F probably damaging Het
Ncstn T C 1: 172,082,592 probably benign Het
Nefm C T 14: 68,124,159 D219N probably damaging Het
Notch2 C T 3: 98,146,537 T2172I possibly damaging Het
Obscn T A 11: 59,133,946 K423* probably null Het
Olfr1164 A C 2: 88,093,628 S103A probably benign Het
Olfr173 T C 16: 58,797,321 N175S probably benign Het
Olfr459 A T 6: 41,772,264 C12S probably benign Het
Olfr606 A G 7: 103,451,628 N97S probably benign Het
Ostm1 T A 10: 42,696,347 M242K probably damaging Het
Oxnad1 T A 14: 32,099,480 I154N probably damaging Het
Pcdhb10 T A 18: 37,413,099 D409E probably damaging Het
Pdcd11 T C 19: 47,125,037 probably benign Het
Peak1 C A 9: 56,258,632 V671L probably benign Het
Pex1 G A 5: 3,606,444 probably null Het
Plk4 T A 3: 40,805,640 F324I probably benign Het
Ppfibp1 C A 6: 147,019,031 probably null Het
Prcp T A 7: 92,919,082 W276R probably damaging Het
Prr14l T C 5: 32,829,880 E757G probably benign Het
Prss52 T A 14: 64,113,644 Y293N probably damaging Het
Prune2 A G 19: 17,006,792 probably benign Het
Ptprk G C 10: 28,585,947 A84P probably damaging Het
Ptprk C T 10: 28,585,948 A84V probably damaging Het
Rock1 A G 18: 10,079,120 L1116P possibly damaging Het
Sdha A T 13: 74,327,333 F526Y probably benign Het
Sema4b T C 7: 80,220,206 F414S probably damaging Het
Serpina12 T C 12: 104,035,701 D252G probably damaging Het
Siglecg C T 7: 43,411,126 A310V probably benign Het
Slc30a8 A G 15: 52,325,570 I194V probably benign Het
Spred3 A G 7: 29,162,975 S148P probably damaging Het
Taf9b A G X: 106,218,408 S58P probably damaging Het
Tgm4 A T 9: 123,062,419 Y109F probably benign Het
Tmprss11c T G 5: 86,237,609 probably benign Het
Tmtc3 A T 10: 100,471,404 V246D probably damaging Het
Tnip1 C T 11: 54,937,994 G116R probably damaging Het
Tpr A G 1: 150,428,241 E1455G possibly damaging Het
Txndc15 A G 13: 55,724,623 I275V possibly damaging Het
Ugt2b1 T A 5: 86,926,456 I15L probably benign Het
Upf2 T C 2: 5,957,634 V49A possibly damaging Het
Vmn1r117 G A 7: 20,883,446 P226S probably benign Het
Vmn2r28 A T 7: 5,490,457 H163Q probably benign Het
Vstm2a T A 11: 16,263,240 S208R probably damaging Het
Zfp346 T A 13: 55,113,097 C79* probably null Het
Zfp628 A T 7: 4,921,616 T946S probably benign Het
Other mutations in Ttc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Ttc3 APN 16 94426761 splice site probably null
IGL00979:Ttc3 APN 16 94456718 missense probably damaging 1.00
IGL01520:Ttc3 APN 16 94390207 missense probably benign 0.04
IGL01663:Ttc3 APN 16 94409731 critical splice donor site probably null
IGL01720:Ttc3 APN 16 94385369 missense probably damaging 0.99
IGL01736:Ttc3 APN 16 94442527 missense probably damaging 0.99
IGL02045:Ttc3 APN 16 94409681 splice site probably benign
IGL02203:Ttc3 APN 16 94418598 splice site probably benign
IGL02327:Ttc3 APN 16 94448108 missense probably damaging 1.00
IGL02794:Ttc3 APN 16 94467926 missense probably damaging 1.00
IGL02898:Ttc3 APN 16 94419426 missense probably damaging 1.00
PIT4378001:Ttc3 UTSW 16 94410906 missense probably benign 0.01
R0064:Ttc3 UTSW 16 94422247 missense possibly damaging 0.79
R0098:Ttc3 UTSW 16 94390265 missense probably benign 0.02
R0112:Ttc3 UTSW 16 94385322 splice site probably benign
R0135:Ttc3 UTSW 16 94462268 missense possibly damaging 0.92
R0513:Ttc3 UTSW 16 94426212 missense probably damaging 1.00
R0532:Ttc3 UTSW 16 94387330 splice site probably benign
R0607:Ttc3 UTSW 16 94456785 nonsense probably null
R0742:Ttc3 UTSW 16 94459880 missense probably benign 0.23
R0905:Ttc3 UTSW 16 94456789 nonsense probably null
R1118:Ttc3 UTSW 16 94416268 splice site probably benign
R1355:Ttc3 UTSW 16 94418637 missense possibly damaging 0.46
R1370:Ttc3 UTSW 16 94418637 missense possibly damaging 0.46
R1486:Ttc3 UTSW 16 94448129 missense probably damaging 1.00
R1598:Ttc3 UTSW 16 94422297 missense probably damaging 1.00
R1641:Ttc3 UTSW 16 94443317 missense probably benign 0.19
R2092:Ttc3 UTSW 16 94442832 missense probably benign 0.02
R2232:Ttc3 UTSW 16 94459972 missense probably benign 0.00
R2339:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R2342:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R2842:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R3117:Ttc3 UTSW 16 94442563 missense possibly damaging 0.51
R4194:Ttc3 UTSW 16 94422277 missense probably damaging 0.99
R4329:Ttc3 UTSW 16 94466961 missense probably damaging 1.00
R4431:Ttc3 UTSW 16 94410958 critical splice donor site probably null
R4530:Ttc3 UTSW 16 94466877 intron probably benign
R4531:Ttc3 UTSW 16 94466877 intron probably benign
R4532:Ttc3 UTSW 16 94466877 intron probably benign
R4533:Ttc3 UTSW 16 94466877 intron probably benign
R4588:Ttc3 UTSW 16 94442901 missense probably benign 0.01
R4625:Ttc3 UTSW 16 94388272 nonsense probably null
R4676:Ttc3 UTSW 16 94442761 missense probably damaging 1.00
R4700:Ttc3 UTSW 16 94439241 splice site probably null
R4856:Ttc3 UTSW 16 94390283 missense probably benign 0.32
R4867:Ttc3 UTSW 16 94454515 missense probably damaging 0.96
R4885:Ttc3 UTSW 16 94419465 missense probably damaging 1.00
R4885:Ttc3 UTSW 16 94426831 critical splice donor site probably null
R4899:Ttc3 UTSW 16 94429455 missense probably damaging 1.00
R4997:Ttc3 UTSW 16 94452982 missense probably damaging 1.00
R5023:Ttc3 UTSW 16 94429359 missense probably benign 0.01
R5105:Ttc3 UTSW 16 94466934 missense possibly damaging 0.94
R5205:Ttc3 UTSW 16 94448059 missense probably benign 0.07
R5287:Ttc3 UTSW 16 94459844 missense probably benign 0.00
R5338:Ttc3 UTSW 16 94384041 missense probably damaging 0.99
R5347:Ttc3 UTSW 16 94429620 missense probably damaging 1.00
R5403:Ttc3 UTSW 16 94459844 missense probably benign 0.00
R5460:Ttc3 UTSW 16 94457382 missense probably benign 0.32
R5739:Ttc3 UTSW 16 94439324 nonsense probably null
R6242:Ttc3 UTSW 16 94442695 missense probably benign 0.04
R6253:Ttc3 UTSW 16 94457413 critical splice donor site probably null
R6455:Ttc3 UTSW 16 94418623 start codon destroyed probably null 0.83
R6559:Ttc3 UTSW 16 94422349 critical splice donor site probably null
R6564:Ttc3 UTSW 16 94442611 missense probably damaging 1.00
R6932:Ttc3 UTSW 16 94443453 missense probably benign
R7331:Ttc3 UTSW 16 94394359 missense probably benign 0.27
R7497:Ttc3 UTSW 16 94418682 missense possibly damaging 0.93
R7610:Ttc3 UTSW 16 94427838 missense probably benign 0.11
R7738:Ttc3 UTSW 16 94387382 missense probably benign 0.00
R7970:Ttc3 UTSW 16 94457364 missense probably damaging 1.00
R8052:Ttc3 UTSW 16 94467989 missense probably benign 0.09
R8087:Ttc3 UTSW 16 94442953 missense probably benign 0.00
R8309:Ttc3 UTSW 16 94466979 missense probably damaging 1.00
R8320:Ttc3 UTSW 16 94418676 missense probably damaging 1.00
R8322:Ttc3 UTSW 16 94454492 missense probably damaging 1.00
R8518:Ttc3 UTSW 16 94457379 missense probably benign 0.21
R8670:Ttc3 UTSW 16 94390208 missense probably damaging 0.99
R8826:Ttc3 UTSW 16 94431970 missense possibly damaging 0.85
R8868:Ttc3 UTSW 16 94451143 missense probably benign 0.00
R8873:Ttc3 UTSW 16 94442983 missense probably damaging 0.97
X0022:Ttc3 UTSW 16 94442525 missense probably benign 0.00
Y5378:Ttc3 UTSW 16 94412129 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACTCGGTACGGAGCATCTCTCAAG -3'
(R):5'- AGCAGTTAGCACGGAAGAATCACAC -3'

Sequencing Primer
(F):5'- CAAGGAGCTTGATTTCCACG -3'
(R):5'- tccctcccctccccctc -3'
Posted On2013-05-23