Mutagenetix > Incidental Mutation

Incidental Mutation 'R0480:Lama3'

41987

Institutional Source

Beutler Lab

Gene Symbol

Lama3

Ensembl Gene

ENSMUSG00000024421

Gene Name

laminin, alpha 3

Synonyms

[a]3B, nicein, 150kDa

MMRRC Submission

038680-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0480 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12333819-12583013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 12450424 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 690 (T690P)

Ref Sequence

ENSEMBL: ENSMUSP00000089703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092070]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092070
AA Change: T690P

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000089703
Gene: ENSMUSG00000024421
AA Change: T690P

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
LamNT	38	294	1.46e-153	SMART
EGF_Lam	296	350	1.39e-4	SMART
EGF_Lam	353	420	2.66e-10	SMART
EGF_Lam	423	464	3.51e-10	SMART
EGF_Lam	488	530	1.73e-9	SMART
EGF_Lam	533	576	3.81e-11	SMART
EGF_like	579	625	1.82e-1	SMART
EGF_Lam	628	678	5.15e-8	SMART
EGF_Lam	681	725	3.54e-6	SMART
low complexity region	768	781	N/A	INTRINSIC
EGF_Lam	1263	1306	3.15e-12	SMART
EGF_Lam	1309	1350	6.3e-3	SMART
EGF_Lam	1353	1399	1.49e-13	SMART
EGF_Lam	1402	1450	8.18e-11	SMART
LamB	1509	1638	4.34e-55	SMART
Pfam:Laminin_EGF	1647	1681	7.9e-5	PFAM
EGF_Lam	1684	1728	2.66e-10	SMART
EGF_Lam	1731	1781	7.81e-8	SMART
Pfam:Laminin_I	1836	2102	2.7e-93	PFAM
low complexity region	2185	2200	N/A	INTRINSIC
coiled coil region	2211	2238	N/A	INTRINSIC
LamG	2406	2566	1.67e-2	SMART
LamG	2614	2742	1.72e-17	SMART
LamG	2785	2900	3.96e-17	SMART
LamG	3005	3133	1.12e-34	SMART
LamG	3175	3308	3.41e-30	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.3%
20x: 92.6%

Validation Efficiency

99% (117/118)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation develop a lethal blistering phenotype similar to human junctional epidermolysis bullosa, and die 2-3 days after birth from a failure to thrive. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	C	T	11: 58,880,186	L165F	probably damaging	Het
Adamts18	A	G	8: 113,738,818	V714A	possibly damaging	Het
Adamtsl1	G	T	4: 86,252,818	A518S	probably benign	Het
Adcy2	C	T	13: 68,732,112	V363M	probably damaging	Het
Ago4	G	T	4: 126,526,077	Q36K	probably benign	Het
Akr1a1	A	G	4: 116,639,847	V172A	possibly damaging	Het
Alkbh2	T	A	5: 114,125,535	N137I	probably damaging	Het
Ank3	T	A	10: 69,879,926	S470T	probably damaging	Het
Ankrd12	T	C	17: 66,049,828	T65A	possibly damaging	Het
Aox1	A	T	1: 58,043,651		probably benign	Het
Arhgap11a	A	T	2: 113,839,818	I320N	probably benign	Het
Arhgap17	G	A	7: 123,294,644	H518Y	probably damaging	Het
Ascc3	T	C	10: 50,735,252	V1563A	probably damaging	Het
Atf2	G	A	2: 73,819,156		probably benign	Het
Bmpr2	C	T	1: 59,845,659	T268I	probably damaging	Het
Bpifb9a	A	G	2: 154,264,688	I380V	probably benign	Het
C2cd2	G	A	16: 97,877,148	T363I	probably benign	Het
Catsperg2	T	G	7: 29,721,298	N190H	probably damaging	Het
Ccdc138	T	C	10: 58,561,967	L543S	probably damaging	Het
Ccdc170	A	T	10: 4,518,939	K162N	probably benign	Het
Cdca5	G	T	19: 6,090,298	R163L	probably damaging	Het
Cdh24	A	G	14: 54,632,597	F239S	probably benign	Het
Cdkl3	T	C	11: 52,005,055	V43A	probably damaging	Het
Cep152	G	T	2: 125,581,719	Q921K	possibly damaging	Het
Cftr	G	A	6: 18,274,518		probably benign	Het
Chmp5	T	C	4: 40,948,690		probably benign	Het
Cit	T	A	5: 115,933,393		probably benign	Het
Cngb3	T	A	4: 19,309,517		probably benign	Het
Cnr2	A	G	4: 135,917,601	E330G	probably benign	Het
Cyp21a1	A	T	17: 34,801,826	L473Q	probably damaging	Het
Dchs1	T	C	7: 105,771,489	T575A	probably benign	Het
Dedd2	A	G	7: 25,203,625	V303A	probably damaging	Het
Dmd	G	T	X: 84,425,738	A2370S	probably benign	Het
Dnah10	T	A	5: 124,808,851	N3009K	probably damaging	Het
Dnajc13	G	T	9: 104,200,509	N934K	probably damaging	Het
Dock1	C	T	7: 134,737,718	L106F	probably damaging	Het
Fat3	A	G	9: 15,997,729	Y2326H	probably benign	Het
Fhl5	A	T	4: 25,207,101	C222*	probably null	Het
Gm10639	C	T	9: 78,302,817	A135V	probably benign	Het
Gm1840	A	G	8: 5,639,888		noncoding transcript	Het
Gnmt	T	C	17: 46,725,928	T252A	probably benign	Het
Gtf2f1	A	G	17: 57,004,307		probably null	Het
Gtf3a	T	C	5: 146,953,229	Y187H	probably damaging	Het
Hdac2	A	G	10: 36,974,792	Y14C	probably damaging	Het
Hnrnph1	T	G	11: 50,385,762		probably benign	Het
Homer2	T	C	7: 81,618,603	D92G	possibly damaging	Het
Hspg2	T	C	4: 137,550,024	S2885P	probably damaging	Het
Insr	A	G	8: 3,161,770	S1084P	probably damaging	Het
Ints11	T	A	4: 155,887,624	V362E	probably damaging	Het
Kank2	T	C	9: 21,779,899	N513S	probably damaging	Het
Kdelc1	C	T	1: 44,110,757	W424*	probably null	Het
Kl	T	G	5: 150,953,288	V191G	probably damaging	Het
Krt23	A	G	11: 99,486,698		probably null	Het
Lamb1	G	A	12: 31,282,721	A281T	possibly damaging	Het
Lck	T	C	4: 129,555,640	E299G	probably damaging	Het
Lonrf1	A	G	8: 36,222,710	V703A	probably damaging	Het
Ly6f	T	C	15: 75,271,677	C78R	probably damaging	Het
Mapkap1	C	T	2: 34,533,781		probably benign	Het
Mast1	T	A	8: 84,913,089	I1204F	probably damaging	Het
Mbd6	C	T	10: 127,285,873		probably benign	Het
Mef2c	A	T	13: 83,592,901	T60S	probably damaging	Het
Mgat4c	C	T	10: 102,389,119	T398I	probably damaging	Het
Mmp12	C	A	9: 7,350,016	H102Q	probably damaging	Het
Mmp20	G	A	9: 7,645,373	G308E	probably damaging	Het
Mms19	A	T	19: 41,954,846	L395Q	probably damaging	Het
Mus81	A	G	19: 5,487,931		probably benign	Het
Mypn	C	T	10: 63,193,203	R27H	probably benign	Het
Nav3	T	C	10: 109,853,300	E372G	probably damaging	Het
Ncoa1	T	A	12: 4,339,105	I57F	probably damaging	Het
Ncstn	T	C	1: 172,082,592		probably benign	Het
Nefm	C	T	14: 68,124,159	D219N	probably damaging	Het
Notch2	C	T	3: 98,146,537	T2172I	possibly damaging	Het
Obscn	T	A	11: 59,133,946	K423*	probably null	Het
Olfr1164	A	C	2: 88,093,628	S103A	probably benign	Het
Olfr173	T	C	16: 58,797,321	N175S	probably benign	Het
Olfr459	A	T	6: 41,772,264	C12S	probably benign	Het
Olfr606	A	G	7: 103,451,628	N97S	probably benign	Het
Ostm1	T	A	10: 42,696,347	M242K	probably damaging	Het
Oxnad1	T	A	14: 32,099,480	I154N	probably damaging	Het
Pcdhb10	T	A	18: 37,413,099	D409E	probably damaging	Het
Pdcd11	T	C	19: 47,125,037		probably benign	Het
Peak1	C	A	9: 56,258,632	V671L	probably benign	Het
Pex1	G	A	5: 3,606,444		probably null	Het
Plk4	T	A	3: 40,805,640	F324I	probably benign	Het
Ppfibp1	C	A	6: 147,019,031		probably null	Het
Prcp	T	A	7: 92,919,082	W276R	probably damaging	Het
Prr14l	T	C	5: 32,829,880	E757G	probably benign	Het
Prss52	T	A	14: 64,113,644	Y293N	probably damaging	Het
Prune2	A	G	19: 17,006,792		probably benign	Het
Ptprk	G	C	10: 28,585,947	A84P	probably damaging	Het
Ptprk	C	T	10: 28,585,948	A84V	probably damaging	Het
Rock1	A	G	18: 10,079,120	L1116P	possibly damaging	Het
Sdha	A	T	13: 74,327,333	F526Y	probably benign	Het
Sema4b	T	C	7: 80,220,206	F414S	probably damaging	Het
Serpina12	T	C	12: 104,035,701	D252G	probably damaging	Het
Siglecg	C	T	7: 43,411,126	A310V	probably benign	Het
Slc30a8	A	G	15: 52,325,570	I194V	probably benign	Het
Spred3	A	G	7: 29,162,975	S148P	probably damaging	Het
Taf9b	A	G	X: 106,218,408	S58P	probably damaging	Het
Tgm4	A	T	9: 123,062,419	Y109F	probably benign	Het
Tmprss11c	T	G	5: 86,237,609		probably benign	Het
Tmtc3	A	T	10: 100,471,404	V246D	probably damaging	Het
Tnip1	C	T	11: 54,937,994	G116R	probably damaging	Het
Tpr	A	G	1: 150,428,241	E1455G	possibly damaging	Het
Ttc3	T	A	16: 94,432,004	L986*	probably null	Het
Txndc15	A	G	13: 55,724,623	I275V	possibly damaging	Het
Ugt2b1	T	A	5: 86,926,456	I15L	probably benign	Het
Upf2	T	C	2: 5,957,634	V49A	possibly damaging	Het
Vmn1r117	G	A	7: 20,883,446	P226S	probably benign	Het
Vmn2r28	A	T	7: 5,490,457	H163Q	probably benign	Het
Vstm2a	T	A	11: 16,263,240	S208R	probably damaging	Het
Zfp346	T	A	13: 55,113,097	C79*	probably null	Het
Zfp628	A	T	7: 4,921,616	T946S	probably benign	Het

Other mutations in Lama3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Lama3	APN	18	12580292	missense	probably benign
IGL00272:Lama3	APN	18	12491548	missense	probably damaging	1.00
IGL00335:Lama3	APN	18	12449588	splice site	probably benign
IGL00836:Lama3	APN	18	12472228	missense	probably benign	0.01
IGL01017:Lama3	APN	18	12441143	critical splice donor site	probably null
IGL01025:Lama3	APN	18	12481037	missense	probably benign	0.09
IGL01394:Lama3	APN	18	12531926	missense	probably null	0.39
IGL01545:Lama3	APN	18	12441131	missense	probably benign	0.01
IGL01685:Lama3	APN	18	12453880	splice site	probably benign
IGL01863:Lama3	APN	18	12419936	splice site	probably benign
IGL01869:Lama3	APN	18	12524763	missense	possibly damaging	0.94
IGL01894:Lama3	APN	18	12572064	missense	probably benign	0.09
IGL02027:Lama3	APN	18	12516513	missense	probably damaging	1.00
IGL02106:Lama3	APN	18	12468314	missense	probably damaging	0.98
IGL02307:Lama3	APN	18	12581783	missense	probably benign	0.09
IGL02342:Lama3	APN	18	12491476	missense	probably damaging	1.00
IGL02377:Lama3	APN	18	12556750	missense	possibly damaging	0.49
IGL02401:Lama3	APN	18	12557727	missense	probably benign	0.02
IGL02517:Lama3	APN	18	12537858	critical splice donor site	probably null
IGL02644:Lama3	APN	18	12525853	missense	probably benign	0.12
IGL02733:Lama3	APN	18	12578127	missense	probably damaging	0.99
IGL02932:Lama3	APN	18	12528801	missense	probably damaging	1.00
IGL03006:Lama3	APN	18	12468368	splice site	probably benign
IGL03038:Lama3	APN	18	12419250	missense	probably damaging	0.99
IGL03064:Lama3	APN	18	12439349	missense	possibly damaging	0.72
IGL03146:Lama3	APN	18	12527624	missense	possibly damaging	0.66
IGL03233:Lama3	APN	18	12481038	missense	probably damaging	1.00
IGL03255:Lama3	APN	18	12539703	missense	probably damaging	1.00
IGL03369:Lama3	APN	18	12553283	missense	probably benign	0.05
IGL03412:Lama3	APN	18	12419182	missense	probably damaging	0.99
IGL02980:Lama3	UTSW	18	12553231	missense	probably benign	0.01
IGL03014:Lama3	UTSW	18	12539967	missense	possibly damaging	0.95
R0007:Lama3	UTSW	18	12497881	splice site	probably benign
R0007:Lama3	UTSW	18	12497881	splice site	probably benign
R0050:Lama3	UTSW	18	12404103	missense	probably damaging	1.00
R0050:Lama3	UTSW	18	12404103	missense	probably damaging	1.00
R0063:Lama3	UTSW	18	12528705	splice site	probably benign
R0063:Lama3	UTSW	18	12528705	splice site	probably benign
R0106:Lama3	UTSW	18	12403982	missense	probably damaging	0.96
R0148:Lama3	UTSW	18	12448272	missense	probably damaging	1.00
R0165:Lama3	UTSW	18	12524810	missense	probably damaging	0.99
R0240:Lama3	UTSW	18	12539823	splice site	probably null
R0240:Lama3	UTSW	18	12539823	splice site	probably null
R0316:Lama3	UTSW	18	12519877	missense	probably benign	0.09
R0325:Lama3	UTSW	18	12482126	missense	probably damaging	1.00
R0365:Lama3	UTSW	18	12507007	missense	probably damaging	0.96
R0390:Lama3	UTSW	18	12407563	missense	probably benign	0.10
R0408:Lama3	UTSW	18	12456837	missense	probably benign
R0449:Lama3	UTSW	18	12500512	splice site	probably null
R0453:Lama3	UTSW	18	12465478	missense	possibly damaging	0.63
R0536:Lama3	UTSW	18	12525894	missense	probably damaging	1.00
R0545:Lama3	UTSW	18	12561701	missense	possibly damaging	0.90
R0567:Lama3	UTSW	18	12549252	missense	probably benign
R0605:Lama3	UTSW	18	12506949	missense	probably benign	0.02
R0617:Lama3	UTSW	18	12419258	critical splice donor site	probably null
R0629:Lama3	UTSW	18	12419245	missense	possibly damaging	0.79
R0671:Lama3	UTSW	18	12477590	missense	possibly damaging	0.80
R0730:Lama3	UTSW	18	12456850	splice site	probably benign
R1216:Lama3	UTSW	18	12421134	splice site	probably benign
R1356:Lama3	UTSW	18	12500577	unclassified	probably benign
R1386:Lama3	UTSW	18	12477370	missense	probably benign	0.04
R1424:Lama3	UTSW	18	12519991	missense	probably benign	0.13
R1426:Lama3	UTSW	18	12481098	critical splice donor site	probably null
R1437:Lama3	UTSW	18	12549227	missense	possibly damaging	0.46
R1468:Lama3	UTSW	18	12441107	missense	probably benign	0.00
R1468:Lama3	UTSW	18	12441107	missense	probably benign	0.00
R1472:Lama3	UTSW	18	12482045	missense	probably benign	0.23
R1557:Lama3	UTSW	18	12513731	splice site	probably benign
R1571:Lama3	UTSW	18	12539717	missense	probably damaging	0.98
R1599:Lama3	UTSW	18	12450400	nonsense	probably null
R1631:Lama3	UTSW	18	12407494	missense	probably damaging	1.00
R1647:Lama3	UTSW	18	12532199	missense	possibly damaging	0.90
R1648:Lama3	UTSW	18	12532199	missense	possibly damaging	0.90
R1719:Lama3	UTSW	18	12479872	critical splice donor site	probably null
R1757:Lama3	UTSW	18	12465499	missense	probably benign	0.10
R1766:Lama3	UTSW	18	12402062	missense	probably damaging	1.00
R1853:Lama3	UTSW	18	12513705	missense	possibly damaging	0.75
R1856:Lama3	UTSW	18	12537781	nonsense	probably null
R1909:Lama3	UTSW	18	12581798	missense	probably benign	0.19
R1913:Lama3	UTSW	18	12495279	missense	probably benign	0.15
R1975:Lama3	UTSW	18	12453863	missense	probably damaging	1.00
R2014:Lama3	UTSW	18	12524721	splice site	probably benign
R2059:Lama3	UTSW	18	12528333	missense	probably damaging	0.98
R2060:Lama3	UTSW	18	12528726	missense	probably benign	0.30
R2086:Lama3	UTSW	18	12524830	missense	probably benign	0.39
R2115:Lama3	UTSW	18	12402849	missense	possibly damaging	0.94
R2291:Lama3	UTSW	18	12525079	missense	probably damaging	0.98
R2860:Lama3	UTSW	18	12453750	missense	probably damaging	1.00
R2861:Lama3	UTSW	18	12453750	missense	probably damaging	1.00
R2862:Lama3	UTSW	18	12453750	missense	probably damaging	1.00
R3410:Lama3	UTSW	18	12413858	critical splice donor site	probably null
R3614:Lama3	UTSW	18	12448288	missense	probably benign	0.03
R3696:Lama3	UTSW	18	12439475	splice site	probably benign
R3752:Lama3	UTSW	18	12507029	missense	probably damaging	1.00
R3967:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R3968:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R3969:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R3970:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R4088:Lama3	UTSW	18	12504308	nonsense	probably null
R4118:Lama3	UTSW	18	12450431	missense	probably benign	0.01
R4222:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4223:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4224:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4225:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4367:Lama3	UTSW	18	12513690	missense	probably damaging	1.00
R4404:Lama3	UTSW	18	12582531	missense	probably benign	0.01
R4424:Lama3	UTSW	18	12519872	nonsense	probably null
R4483:Lama3	UTSW	18	12549253	missense	probably benign	0.32
R4484:Lama3	UTSW	18	12481088	missense	probably benign
R4516:Lama3	UTSW	18	12495358	missense	probably damaging	1.00
R4556:Lama3	UTSW	18	12479759	missense	possibly damaging	0.63
R4616:Lama3	UTSW	18	12504397	critical splice donor site	probably null
R4702:Lama3	UTSW	18	12578029	nonsense	probably null
R4704:Lama3	UTSW	18	12553223	missense	probably benign	0.08
R4750:Lama3	UTSW	18	12504359	missense	probably benign	0.25
R4753:Lama3	UTSW	18	12482084	missense	probably damaging	1.00
R4767:Lama3	UTSW	18	12500563	missense	probably benign	0.32
R4777:Lama3	UTSW	18	12413771	missense	probably damaging	1.00
R4782:Lama3	UTSW	18	12411570	nonsense	probably null
R4784:Lama3	UTSW	18	12449544	missense	probably benign	0.20
R4816:Lama3	UTSW	18	12477604	missense	possibly damaging	0.93
R4833:Lama3	UTSW	18	12441131	missense	probably benign	0.01
R4854:Lama3	UTSW	18	12411542	missense	probably benign	0.00
R4863:Lama3	UTSW	18	12498678	intron	probably benign
R4863:Lama3	UTSW	18	12539793	missense	probably damaging	0.99
R4953:Lama3	UTSW	18	12448305	missense	probably damaging	1.00
R4974:Lama3	UTSW	18	12552826	missense	probably damaging	0.98
R4996:Lama3	UTSW	18	12518743	missense	probably benign	0.24
R5049:Lama3	UTSW	18	12582611	missense	probably benign	0.19
R5057:Lama3	UTSW	18	12531948	missense	probably null	0.82
R5090:Lama3	UTSW	18	12542402	missense	possibly damaging	0.94
R5122:Lama3	UTSW	18	12539766	missense	possibly damaging	0.53
R5215:Lama3	UTSW	18	12577900	missense	probably damaging	1.00
R5245:Lama3	UTSW	18	12419893	missense	probably damaging	1.00
R5259:Lama3	UTSW	18	12465508	missense	probably damaging	1.00
R5320:Lama3	UTSW	18	12552855	missense	probably damaging	0.99
R5377:Lama3	UTSW	18	12453746	missense	probably damaging	0.99
R5432:Lama3	UTSW	18	12572066	missense	probably damaging	1.00
R5500:Lama3	UTSW	18	12456764	missense	possibly damaging	0.93
R5534:Lama3	UTSW	18	12553210	missense	probably benign	0.00
R5589:Lama3	UTSW	18	12472220	missense	possibly damaging	0.46
R5604:Lama3	UTSW	18	12439348	missense	probably benign
R5617:Lama3	UTSW	18	12498936	intron	probably benign
R5709:Lama3	UTSW	18	12539799	missense	probably damaging	1.00
R5965:Lama3	UTSW	18	12429887	missense	possibly damaging	0.67
R6042:Lama3	UTSW	18	12574254	missense	probably damaging	1.00
R6065:Lama3	UTSW	18	12469928	missense	possibly damaging	0.53
R6085:Lama3	UTSW	18	12482099	missense	probably benign	0.01
R6212:Lama3	UTSW	18	12513645	missense	probably damaging	1.00
R6268:Lama3	UTSW	18	12524737	missense	probably damaging	0.98
R6276:Lama3	UTSW	18	12506949	missense	probably benign	0.02
R6366:Lama3	UTSW	18	12482137	missense	probably damaging	1.00
R6393:Lama3	UTSW	18	12479756	missense	probably benign	0.44
R6493:Lama3	UTSW	18	12482148	critical splice donor site	probably null
R6505:Lama3	UTSW	18	12495348	missense	probably benign	0.02
R6563:Lama3	UTSW	18	12537766	missense	probably damaging	1.00
R6582:Lama3	UTSW	18	12577840	missense	probably damaging	1.00
R6585:Lama3	UTSW	18	12419257	critical splice donor site	probably null
R6609:Lama3	UTSW	18	12513678	missense	probably damaging	0.99
R6656:Lama3	UTSW	18	12549226	missense	possibly damaging	0.66
R6833:Lama3	UTSW	18	12491548	missense	probably damaging	1.00
R6834:Lama3	UTSW	18	12491548	missense	probably damaging	1.00
R7019:Lama3	UTSW	18	12528418	missense	probably damaging	0.97
R7026:Lama3	UTSW	18	12516548	missense	probably damaging	0.98
R7088:Lama3	UTSW	18	12582545	missense	possibly damaging	0.90
R7100:Lama3	UTSW	18	12582644	missense	possibly damaging	0.80
R7102:Lama3	UTSW	18	12552813	missense	possibly damaging	0.66
R7103:Lama3	UTSW	18	12531879	missense	probably benign	0.00
R7121:Lama3	UTSW	18	12462782	missense	probably benign	0.06
R7133:Lama3	UTSW	18	12539786	missense	probably benign	0.05
R7150:Lama3	UTSW	18	12468289	missense	probably damaging	1.00
R7158:Lama3	UTSW	18	12456812	missense	probably benign	0.20
R7170:Lama3	UTSW	18	12404076	missense	probably benign	0.26
R7216:Lama3	UTSW	18	12430000	missense	probably damaging	1.00
R7223:Lama3	UTSW	18	12582608	missense	possibly damaging	0.53
R7243:Lama3	UTSW	18	12419845	missense	probably damaging	1.00
R7282:Lama3	UTSW	18	12439392	missense	probably damaging	0.99
R7337:Lama3	UTSW	18	12507040	splice site	probably null
R7442:Lama3	UTSW	18	12472181	critical splice acceptor site	probably null
R7487:Lama3	UTSW	18	12419237	missense	probably benign
R7604:Lama3	UTSW	18	12500493	missense	possibly damaging	0.93
R7609:Lama3	UTSW	18	12531834	critical splice acceptor site	probably null
R7650:Lama3	UTSW	18	12537838	missense	probably benign	0.01
R7894:Lama3	UTSW	18	12462807	missense	probably benign	0.07
R7975:Lama3	UTSW	18	12537739	missense	probably damaging	1.00
R8099:Lama3	UTSW	18	12534063	missense	probably damaging	0.97
R8168:Lama3	UTSW	18	12506942	missense	probably null
R8219:Lama3	UTSW	18	12439360	missense	probably benign	0.07
R8227:Lama3	UTSW	18	12407551	missense	probably benign
R8229:Lama3	UTSW	18	12407551	missense	probably benign
R8298:Lama3	UTSW	18	12525853	missense	probably benign	0.12
R8351:Lama3	UTSW	18	12540613	missense	probably damaging	1.00
R8364:Lama3	UTSW	18	12528347	missense	probably damaging	0.99
R8463:Lama3	UTSW	18	12449839	missense	probably damaging	0.96
R8515:Lama3	UTSW	18	12411631	missense	probably null	0.01
R8784:Lama3	UTSW	18	12421155	missense	probably benign
R8799:Lama3	UTSW	18	12490943	missense	probably damaging	0.96
R8874:Lama3	UTSW	18	12449586	critical splice donor site	probably null
R8938:Lama3	UTSW	18	12556705	missense	probably damaging	1.00
R8967:Lama3	UTSW	18	12532039	missense	possibly damaging	0.46
R9039:Lama3	UTSW	18	12481063	nonsense	probably null
R9126:Lama3	UTSW	18	12450470	missense	probably damaging	1.00
R9200:Lama3	UTSW	18	12472240	missense	probably benign	0.00
R9203:Lama3	UTSW	18	12462812	missense	probably benign	0.04
R9246:Lama3	UTSW	18	12577902	missense	probably damaging	0.99
R9284:Lama3	UTSW	18	12450484	nonsense	probably null
R9553:Lama3	UTSW	18	12429962	missense	probably damaging	1.00
R9716:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R9734:Lama3	UTSW	18	12549263	missense	possibly damaging	0.94
X0019:Lama3	UTSW	18	12582574	missense	possibly damaging	0.94
Z1177:Lama3	UTSW	18	12429879	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGCTGACTTTCAAGGATGGAGGAC -3'
(R):5'- AGGGGCTTTGTAGCTTATGCCAC -3'

Sequencing Primer
(F):5'- GTTGACACTTGCAGTGAACC -3'
(R):5'- TGTAGCTTATGCCACAGAACTGG -3'

Posted On

2013-05-23