Incidental Mutation 'R0482:Cacna1s'
ID41999
Institutional Source Beutler Lab
Gene Symbol Cacna1s
Ensembl Gene ENSMUSG00000026407
Gene Namecalcium channel, voltage-dependent, L type, alpha 1S subunit
Synonymssj, mdg, muscle dysgenesis, DHPR alpha1s, Cav1.1, Cchl1a3, fmd
MMRRC Submission 038682-MU
Accession Numbers

Genbank: NM_001081023; MGI: 88294

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0482 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location136052750-136119822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 136113394 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1286 (T1286I)
Ref Sequence ENSEMBL: ENSMUSP00000125262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112064] [ENSMUST00000112068] [ENSMUST00000160641] [ENSMUST00000161865]
Predicted Effect probably benign
Transcript: ENSMUST00000112064
AA Change: T1552I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107695
Gene: ENSMUSG00000026407
AA Change: T1552I

DomainStartEndE-ValueType
Pfam:Ion_trans 50 345 4.3e-68 PFAM
Pfam:Ion_trans 431 672 4.5e-56 PFAM
Pfam:PKD_channel 516 667 1.9e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
Pfam:Ion_trans 798 1076 2.6e-65 PFAM
Pfam:Ion_trans 1117 1392 1.2e-71 PFAM
Pfam:PKD_channel 1126 1387 8.4e-13 PFAM
Pfam:GPHH 1394 1463 2.3e-38 PFAM
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Pfam:CAC1F_C 1756 1845 2.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112068
AA Change: T1533I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107699
Gene: ENSMUSG00000026407
AA Change: T1533I

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.1e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.7e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 3.9e-53 PFAM
Pfam:Ion_trans 1152 1361 6.7e-66 PFAM
Pfam:PKD_channel 1201 1368 8.4e-10 PFAM
Blast:EFh 1382 1410 5e-8 BLAST
Ca_chan_IQ 1496 1529 3.71e-14 SMART
low complexity region 1638 1650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159106
Predicted Effect probably benign
Transcript: ENSMUST00000160641
AA Change: T1552I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125278
Gene: ENSMUSG00000026407
AA Change: T1552I

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.3e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.8e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 4e-53 PFAM
Pfam:PKD_channel 1126 1387 6.1e-12 PFAM
Pfam:Ion_trans 1152 1380 9e-65 PFAM
Blast:EFh 1401 1429 5e-8 BLAST
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161700
Predicted Effect probably benign
Transcript: ENSMUST00000161865
AA Change: T1286I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125262
Gene: ENSMUSG00000026407
AA Change: T1286I

DomainStartEndE-ValueType
Pfam:Ion_trans 3 98 1.1e-21 PFAM
Pfam:Ion_trans 184 425 3.3e-56 PFAM
Pfam:PKD_channel 267 420 1.8e-7 PFAM
low complexity region 428 438 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
Pfam:Ion_trans 551 829 1.9e-65 PFAM
Pfam:Ion_trans 870 1126 5.4e-72 PFAM
Pfam:PKD_channel 954 1121 7.2e-10 PFAM
Pfam:GPHH 1128 1197 1.8e-38 PFAM
Ca_chan_IQ 1249 1282 3.71e-14 SMART
low complexity region 1391 1403 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194155
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 95% (94/99)
MGI Phenotype Strain: 1856326
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the five subunits of the slowly inactivating L-type voltage-dependent calcium channel in skeletal muscle cells. Mutations in this gene have been associated with hypokalemic periodic paralysis, thyrotoxic periodic paralysis and malignant hyperthermia susceptibility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show edema and failure of myoblast differentiation by day 13 of embryonic development and die perinatally. All muscles degenerate and additional secondary anomalies of the skeleton, short jaw, and cleft palate are seen. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Spontaneous(1)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,988,423 probably null Het
Abca13 G A 11: 9,328,207 G3129D possibly damaging Het
Acnat2 T C 4: 49,383,534 I6M probably benign Het
Adcy4 T A 14: 55,774,572 probably null Het
Agrn A G 4: 156,173,555 S1117P probably damaging Het
Anks1b A G 10: 90,359,195 N545S probably benign Het
Antxr1 C T 6: 87,269,238 probably null Het
Arhgef17 T C 7: 100,880,621 K476E probably damaging Het
Bptf T C 11: 107,081,262 S927G probably benign Het
Ccdc174 T A 6: 91,895,266 M292K probably benign Het
Cdk5rap2 G A 4: 70,410,269 probably benign Het
Celsr3 T A 9: 108,829,073 Y918* probably null Het
Cep250 T C 2: 155,964,974 probably benign Het
Ces2h A G 8: 105,020,271 D513G possibly damaging Het
Clec2l A G 6: 38,663,392 T53A probably benign Het
Cntnap2 C T 6: 45,715,816 S77L probably benign Het
Cped1 A T 6: 22,016,958 H102L probably benign Het
Crim1 T A 17: 78,372,579 D916E probably benign Het
Csmd1 T A 8: 16,233,101 I614F probably damaging Het
Csnk1g1 G A 9: 66,010,469 E37K probably damaging Het
Ctnnbl1 T A 2: 157,871,190 probably null Het
Cuzd1 A T 7: 131,309,872 probably benign Het
Cyp4f16 T A 17: 32,550,551 V433D probably damaging Het
Ddi1 A G 9: 6,266,144 L75P probably damaging Het
Ddias G A 7: 92,859,528 A393V probably benign Het
Dgka A T 10: 128,734,121 Y123* probably null Het
Dlgap1 T C 17: 70,516,190 C57R probably benign Het
Dysf T A 6: 84,152,405 V1458D probably benign Het
Eif2ak4 T A 2: 118,462,347 Y1230N probably damaging Het
Fam160a2 G A 7: 105,384,212 P599L possibly damaging Het
Fam46a T C 9: 85,325,055 Y230C probably damaging Het
Fbxl7 A T 15: 26,543,546 S338R probably benign Het
Fgf23 A T 6: 127,073,159 T44S probably damaging Het
Folh1 A T 7: 86,746,101 probably benign Het
Gpsm2 A T 3: 108,702,394 probably benign Het
Hdac2 T A 10: 36,989,134 probably benign Het
Hist1h2bl A G 13: 21,716,125 probably benign Het
Il31ra G T 13: 112,527,481 T446N possibly damaging Het
Irf5 T A 6: 29,535,370 L199H probably benign Het
Kif18a T A 2: 109,287,843 M1K probably null Het
Kif4-ps A C 12: 101,148,662 I1017L probably benign Het
Klhl2 C T 8: 64,758,130 V295M probably benign Het
Krt75 A T 15: 101,570,311 M296K probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lgr4 T C 2: 110,008,092 S439P probably damaging Het
Lhfpl2 C A 13: 94,174,610 N129K probably damaging Het
Lnx2 A G 5: 147,018,961 V675A probably damaging Het
Med13 T C 11: 86,285,151 T1673A probably benign Het
Mif A G 10: 75,860,140 V10A possibly damaging Het
Mki67 A T 7: 135,699,429 I1292N possibly damaging Het
Mylip C A 13: 45,404,583 N89K probably benign Het
Myo19 G T 11: 84,909,419 D877Y probably benign Het
Nckap5 A G 1: 126,026,365 S753P possibly damaging Het
Nlrc3 T C 16: 3,965,192 T118A possibly damaging Het
Nptx2 T C 5: 144,553,459 Y233H probably damaging Het
Nsl1 T A 1: 191,063,040 M1K probably null Het
Ntsr1 T A 2: 180,501,056 S213R possibly damaging Het
Olfr1225 A T 2: 89,170,631 F194I probably benign Het
Olfr48 A G 2: 89,844,169 V268A probably benign Het
Olfr669 T A 7: 104,938,814 F96Y possibly damaging Het
Pde4d G A 13: 109,936,710 V347I probably benign Het
Pik3r4 T A 9: 105,669,045 S865T probably benign Het
Ppp2r2d A G 7: 138,870,431 R136G probably benign Het
Proser2 A C 2: 6,113,910 S41A probably damaging Het
Proz A T 8: 13,073,460 K244* probably null Het
Prpf38b A T 3: 108,905,270 L209H probably damaging Het
R3hdm1 C A 1: 128,184,517 A390E probably benign Het
Rb1cc1 A C 1: 6,240,323 D315A probably damaging Het
Rnf141 G A 7: 110,837,138 R28* probably null Het
Rps6kc1 A T 1: 190,799,430 S792T probably benign Het
Rxrg A G 1: 167,631,037 D233G possibly damaging Het
Sh2d7 A G 9: 54,541,037 N114S probably benign Het
Slc25a38 T C 9: 120,120,833 V205A probably benign Het
Slc4a10 T C 2: 62,297,017 probably benign Het
Spred1 T A 2: 117,152,978 probably null Het
Stt3b A G 9: 115,248,567 S706P probably benign Het
Tcerg1 C A 18: 42,564,240 probably benign Het
Thsd4 A T 9: 60,002,978 I109N probably damaging Het
Ticrr C A 7: 79,694,488 P1367Q probably damaging Het
Trpv1 A G 11: 73,239,429 D146G probably damaging Het
Tubd1 T G 11: 86,557,776 V305G possibly damaging Het
Tubgcp4 T C 2: 121,175,374 L81P probably benign Het
Ubxn2b T A 4: 6,196,404 probably null Het
Usp36 A T 11: 118,265,194 S586T probably benign Het
Vcan T A 13: 89,678,145 D2220V probably damaging Het
Vmn1r173 T A 7: 23,702,791 N150K probably damaging Het
Vmn1r70 G A 7: 10,634,277 A231T probably damaging Het
Vmn2r97 A G 17: 18,947,668 D728G probably damaging Het
Zbtb40 T C 4: 136,983,228 E1200G probably damaging Het
Zfp365 A T 10: 67,897,606 V252D probably damaging Het
Other mutations in Cacna1s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Cacna1s APN 1 136084273 nonsense probably null
IGL00517:Cacna1s APN 1 136087339 missense probably damaging 1.00
IGL01316:Cacna1s APN 1 136118964 missense probably benign 0.01
IGL01348:Cacna1s APN 1 136075152 missense possibly damaging 0.95
IGL01739:Cacna1s APN 1 136097132 critical splice donor site probably null
IGL01773:Cacna1s APN 1 136118753 missense probably benign 0.32
IGL02056:Cacna1s APN 1 136119000 missense probably benign
IGL02262:Cacna1s APN 1 136108129 missense probably damaging 0.98
IGL02324:Cacna1s APN 1 136075176 splice site probably benign
IGL02352:Cacna1s APN 1 136093252 splice site probably benign
IGL02359:Cacna1s APN 1 136093252 splice site probably benign
IGL02370:Cacna1s APN 1 136085347 missense probably damaging 1.00
IGL02377:Cacna1s APN 1 136068994 missense probably damaging 1.00
IGL02474:Cacna1s APN 1 136118380 missense probably benign
IGL02606:Cacna1s APN 1 136079519 missense probably damaging 0.99
IGL02833:Cacna1s APN 1 136071005 missense probably benign 0.03
IGL02974:Cacna1s APN 1 136092617 missense possibly damaging 0.78
IGL03064:Cacna1s APN 1 136111993 missense probably damaging 1.00
IGL03093:Cacna1s APN 1 136116064 missense probably benign 0.00
IGL03286:Cacna1s APN 1 136077659 missense probably benign
BB009:Cacna1s UTSW 1 136084359 missense probably damaging 0.99
BB019:Cacna1s UTSW 1 136084359 missense probably damaging 0.99
N/A:Cacna1s UTSW 1 136073509 missense probably benign 0.00
R0030:Cacna1s UTSW 1 136094989 critical splice donor site probably null
R0030:Cacna1s UTSW 1 136094989 critical splice donor site probably null
R0097:Cacna1s UTSW 1 136100622 missense possibly damaging 0.79
R0097:Cacna1s UTSW 1 136100622 missense possibly damaging 0.79
R0240:Cacna1s UTSW 1 136073496 unclassified probably benign
R0255:Cacna1s UTSW 1 136118806 missense possibly damaging 0.93
R0302:Cacna1s UTSW 1 136100604 missense probably benign 0.01
R0319:Cacna1s UTSW 1 136070717 missense probably damaging 0.99
R0411:Cacna1s UTSW 1 136113303 missense probably damaging 1.00
R0413:Cacna1s UTSW 1 136098209 missense probably benign 0.00
R0491:Cacna1s UTSW 1 136089008 splice site probably benign
R0518:Cacna1s UTSW 1 136076859 missense probably benign
R0717:Cacna1s UTSW 1 136098291 missense probably damaging 1.00
R0725:Cacna1s UTSW 1 136098526 splice site probably benign
R0815:Cacna1s UTSW 1 136112957 missense possibly damaging 0.95
R1384:Cacna1s UTSW 1 136094971 missense probably benign 0.02
R1518:Cacna1s UTSW 1 136098551 missense probably damaging 1.00
R1548:Cacna1s UTSW 1 136110937 missense probably damaging 1.00
R1725:Cacna1s UTSW 1 136098623 missense probably damaging 1.00
R1728:Cacna1s UTSW 1 136118716 missense probably benign
R1729:Cacna1s UTSW 1 136118716 missense probably benign
R1730:Cacna1s UTSW 1 136118716 missense probably benign
R1739:Cacna1s UTSW 1 136118716 missense probably benign
R1762:Cacna1s UTSW 1 136118716 missense probably benign
R1783:Cacna1s UTSW 1 136118716 missense probably benign
R1784:Cacna1s UTSW 1 136118716 missense probably benign
R1785:Cacna1s UTSW 1 136118716 missense probably benign
R1800:Cacna1s UTSW 1 136076854 missense probably benign
R1924:Cacna1s UTSW 1 136089017 splice site probably null
R1969:Cacna1s UTSW 1 136119095 missense probably benign 0.42
R2072:Cacna1s UTSW 1 136079504 missense probably benign
R2380:Cacna1s UTSW 1 136095848 missense probably damaging 1.00
R3110:Cacna1s UTSW 1 136075093 nonsense probably null
R3112:Cacna1s UTSW 1 136075093 nonsense probably null
R3151:Cacna1s UTSW 1 136105794 missense probably damaging 1.00
R3696:Cacna1s UTSW 1 136105814 missense probably damaging 1.00
R3722:Cacna1s UTSW 1 136069042 missense possibly damaging 0.77
R3804:Cacna1s UTSW 1 136107018 missense possibly damaging 0.85
R3813:Cacna1s UTSW 1 136085347 missense probably damaging 1.00
R3905:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R3907:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R3909:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R4170:Cacna1s UTSW 1 136108195 missense probably damaging 1.00
R4329:Cacna1s UTSW 1 136119033 missense probably benign 0.00
R4485:Cacna1s UTSW 1 136076852 missense probably damaging 1.00
R4581:Cacna1s UTSW 1 136070970 unclassified probably null
R4719:Cacna1s UTSW 1 136118652 splice site probably benign
R4816:Cacna1s UTSW 1 136115269 missense possibly damaging 0.89
R4909:Cacna1s UTSW 1 136079604 missense probably damaging 0.99
R4917:Cacna1s UTSW 1 136101564 critical splice donor site probably null
R5296:Cacna1s UTSW 1 136095785 missense probably benign 0.11
R5411:Cacna1s UTSW 1 136105811 missense probably benign 0.09
R5503:Cacna1s UTSW 1 136086742 missense probably damaging 1.00
R5533:Cacna1s UTSW 1 136098375 critical splice donor site probably null
R5714:Cacna1s UTSW 1 136112066 missense probably benign 0.44
R5775:Cacna1s UTSW 1 136108122 missense probably damaging 1.00
R5814:Cacna1s UTSW 1 136107142 missense probably benign 0.31
R5820:Cacna1s UTSW 1 136079604 missense probably damaging 1.00
R5822:Cacna1s UTSW 1 136112078 missense probably damaging 1.00
R5877:Cacna1s UTSW 1 136100667 missense probably damaging 0.99
R5923:Cacna1s UTSW 1 136076822 missense possibly damaging 0.79
R6021:Cacna1s UTSW 1 136106487 missense probably benign 0.15
R6037:Cacna1s UTSW 1 136070967 missense possibly damaging 0.90
R6037:Cacna1s UTSW 1 136070967 missense possibly damaging 0.90
R6056:Cacna1s UTSW 1 136105836 missense probably damaging 1.00
R6143:Cacna1s UTSW 1 136076758 missense probably damaging 0.99
R6222:Cacna1s UTSW 1 136104622 missense probably benign 0.00
R6237:Cacna1s UTSW 1 136105844 missense possibly damaging 0.88
R6274:Cacna1s UTSW 1 136089045 missense probably benign 0.02
R6609:Cacna1s UTSW 1 136113391 missense probably benign 0.30
R6626:Cacna1s UTSW 1 136094965 missense probably damaging 1.00
R6838:Cacna1s UTSW 1 136084437 missense possibly damaging 0.91
R6848:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6849:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6850:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6851:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6868:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6879:Cacna1s UTSW 1 136115959 missense probably benign 0.12
R6893:Cacna1s UTSW 1 136077693 missense probably benign 0.05
R7017:Cacna1s UTSW 1 136095858 missense probably damaging 0.99
R7228:Cacna1s UTSW 1 136071059 missense possibly damaging 0.90
R7283:Cacna1s UTSW 1 136073708 missense probably damaging 1.00
R7357:Cacna1s UTSW 1 136071021 missense probably damaging 0.99
R7385:Cacna1s UTSW 1 136092633 missense probably damaging 0.99
R7421:Cacna1s UTSW 1 136086802 missense probably damaging 1.00
R7505:Cacna1s UTSW 1 136085449 nonsense probably null
R7519:Cacna1s UTSW 1 136070756 missense probably damaging 0.99
R7675:Cacna1s UTSW 1 136110874 missense probably damaging 1.00
R7746:Cacna1s UTSW 1 136069018 missense probably damaging 0.99
R7779:Cacna1s UTSW 1 136119029 missense probably damaging 1.00
R7850:Cacna1s UTSW 1 136071048 missense probably damaging 1.00
R7932:Cacna1s UTSW 1 136084359 missense probably damaging 0.99
R8083:Cacna1s UTSW 1 136095791 missense possibly damaging 0.91
R8101:Cacna1s UTSW 1 136118665 missense probably benign 0.02
R8123:Cacna1s UTSW 1 136108179 missense probably damaging 1.00
R8191:Cacna1s UTSW 1 136108155 missense probably damaging 1.00
R8194:Cacna1s UTSW 1 136077692 missense probably benign 0.33
R8251:Cacna1s UTSW 1 136086723 missense probably damaging 1.00
R8265:Cacna1s UTSW 1 136092626 nonsense probably null
R8310:Cacna1s UTSW 1 136087337 missense probably damaging 1.00
X0025:Cacna1s UTSW 1 136115970 missense probably benign 0.00
Z1176:Cacna1s UTSW 1 136107084 nonsense probably null
Z1177:Cacna1s UTSW 1 136117686 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGGTGAAAGGTGTCCACTCAAC -3'
(R):5'- TGCAGCAGTGGTCTCCTTATCAAAG -3'

Sequencing Primer
(F):5'- TCAACACTTCAGCAGGATGG -3'
(R):5'- TGTTCAGTCACTCAGAGATAAGG -3'
Posted On2013-05-23