Incidental Mutation 'R0482:Nsl1'
ID42002
Institutional Source Beutler Lab
Gene Symbol Nsl1
Ensembl Gene ENSMUSG00000062510
Gene NameNSL1, MIS12 kinetochore complex component
SynonymsLOC381318, 4833432M17Rik
MMRRC Submission 038682-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R0482 (G1)
Quality Score140
Status Validated
Chromosome1
Chromosomal Location191063012-191086474 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 191063040 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000115289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027945] [ENSMUST00000076952] [ENSMUST00000078259] [ENSMUST00000085633] [ENSMUST00000110891] [ENSMUST00000110893] [ENSMUST00000139340]
Predicted Effect probably benign
Transcript: ENSMUST00000027945
SMART Domains Protein: ENSMUSP00000027945
Gene: ENSMUSG00000026632

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 263 5e-57 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000076952
AA Change: M1K

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076220
Gene: ENSMUSG00000062510
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:Mis14 67 170 1.6e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000078259
AA Change: M1K

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000077380
Gene: ENSMUSG00000062510
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:Mis14 82 197 2.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085633
SMART Domains Protein: ENSMUSP00000082773
Gene: ENSMUSG00000026632

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 170 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110891
SMART Domains Protein: ENSMUSP00000106516
Gene: ENSMUSG00000026632

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 231 2.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110893
SMART Domains Protein: ENSMUSP00000106518
Gene: ENSMUSG00000026632

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 264 1.8e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124497
Predicted Effect probably null
Transcript: ENSMUST00000139340
AA Change: M1K

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115289
Gene: ENSMUSG00000062510
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:Mis14 67 171 7e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156527
Meta Mutation Damage Score 0.9475 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two coiled-coil domains that localizes to kinetochores, which are chromosome-associated structures that attach to microtubules and mediate chromosome movements during cell division. The encoded protein is part of a conserved protein complex that includes two chromodomain-containing proteins and a component of the outer plate of the kinetochore. This protein complex is proposed to bridge centromeric heterochromatin with the outer kinetochore structure. Multiple transcript variants encoding different isoforms have been found for this gene. There is a pseudogene of the 3' UTR region of this gene on chromosome X. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,988,423 probably null Het
Abca13 G A 11: 9,328,207 G3129D possibly damaging Het
Acnat2 T C 4: 49,383,534 I6M probably benign Het
Adcy4 T A 14: 55,774,572 probably null Het
Agrn A G 4: 156,173,555 S1117P probably damaging Het
Anks1b A G 10: 90,359,195 N545S probably benign Het
Antxr1 C T 6: 87,269,238 probably null Het
Arhgef17 T C 7: 100,880,621 K476E probably damaging Het
Bptf T C 11: 107,081,262 S927G probably benign Het
Cacna1s C T 1: 136,113,394 T1286I probably benign Het
Ccdc174 T A 6: 91,895,266 M292K probably benign Het
Cdk5rap2 G A 4: 70,410,269 probably benign Het
Celsr3 T A 9: 108,829,073 Y918* probably null Het
Cep250 T C 2: 155,964,974 probably benign Het
Ces2h A G 8: 105,020,271 D513G possibly damaging Het
Clec2l A G 6: 38,663,392 T53A probably benign Het
Cntnap2 C T 6: 45,715,816 S77L probably benign Het
Cped1 A T 6: 22,016,958 H102L probably benign Het
Crim1 T A 17: 78,372,579 D916E probably benign Het
Csmd1 T A 8: 16,233,101 I614F probably damaging Het
Csnk1g1 G A 9: 66,010,469 E37K probably damaging Het
Ctnnbl1 T A 2: 157,871,190 probably null Het
Cuzd1 A T 7: 131,309,872 probably benign Het
Cyp4f16 T A 17: 32,550,551 V433D probably damaging Het
Ddi1 A G 9: 6,266,144 L75P probably damaging Het
Ddias G A 7: 92,859,528 A393V probably benign Het
Dgka A T 10: 128,734,121 Y123* probably null Het
Dlgap1 T C 17: 70,516,190 C57R probably benign Het
Dysf T A 6: 84,152,405 V1458D probably benign Het
Eif2ak4 T A 2: 118,462,347 Y1230N probably damaging Het
Fam160a2 G A 7: 105,384,212 P599L possibly damaging Het
Fam46a T C 9: 85,325,055 Y230C probably damaging Het
Fbxl7 A T 15: 26,543,546 S338R probably benign Het
Fgf23 A T 6: 127,073,159 T44S probably damaging Het
Folh1 A T 7: 86,746,101 probably benign Het
Gpsm2 A T 3: 108,702,394 probably benign Het
Hdac2 T A 10: 36,989,134 probably benign Het
Hist1h2bl A G 13: 21,716,125 probably benign Het
Il31ra G T 13: 112,527,481 T446N possibly damaging Het
Irf5 T A 6: 29,535,370 L199H probably benign Het
Kif18a T A 2: 109,287,843 M1K probably null Het
Kif4-ps A C 12: 101,148,662 I1017L probably benign Het
Klhl2 C T 8: 64,758,130 V295M probably benign Het
Krt75 A T 15: 101,570,311 M296K probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lgr4 T C 2: 110,008,092 S439P probably damaging Het
Lhfpl2 C A 13: 94,174,610 N129K probably damaging Het
Lnx2 A G 5: 147,018,961 V675A probably damaging Het
Med13 T C 11: 86,285,151 T1673A probably benign Het
Mif A G 10: 75,860,140 V10A possibly damaging Het
Mki67 A T 7: 135,699,429 I1292N possibly damaging Het
Mylip C A 13: 45,404,583 N89K probably benign Het
Myo19 G T 11: 84,909,419 D877Y probably benign Het
Nckap5 A G 1: 126,026,365 S753P possibly damaging Het
Nlrc3 T C 16: 3,965,192 T118A possibly damaging Het
Nptx2 T C 5: 144,553,459 Y233H probably damaging Het
Ntsr1 T A 2: 180,501,056 S213R possibly damaging Het
Olfr1225 A T 2: 89,170,631 F194I probably benign Het
Olfr48 A G 2: 89,844,169 V268A probably benign Het
Olfr669 T A 7: 104,938,814 F96Y possibly damaging Het
Pde4d G A 13: 109,936,710 V347I probably benign Het
Pik3r4 T A 9: 105,669,045 S865T probably benign Het
Ppp2r2d A G 7: 138,870,431 R136G probably benign Het
Proser2 A C 2: 6,113,910 S41A probably damaging Het
Proz A T 8: 13,073,460 K244* probably null Het
Prpf38b A T 3: 108,905,270 L209H probably damaging Het
R3hdm1 C A 1: 128,184,517 A390E probably benign Het
Rb1cc1 A C 1: 6,240,323 D315A probably damaging Het
Rnf141 G A 7: 110,837,138 R28* probably null Het
Rps6kc1 A T 1: 190,799,430 S792T probably benign Het
Rxrg A G 1: 167,631,037 D233G possibly damaging Het
Sh2d7 A G 9: 54,541,037 N114S probably benign Het
Slc25a38 T C 9: 120,120,833 V205A probably benign Het
Slc4a10 T C 2: 62,297,017 probably benign Het
Spred1 T A 2: 117,152,978 probably null Het
Stt3b A G 9: 115,248,567 S706P probably benign Het
Tcerg1 C A 18: 42,564,240 probably benign Het
Thsd4 A T 9: 60,002,978 I109N probably damaging Het
Ticrr C A 7: 79,694,488 P1367Q probably damaging Het
Trpv1 A G 11: 73,239,429 D146G probably damaging Het
Tubd1 T G 11: 86,557,776 V305G possibly damaging Het
Tubgcp4 T C 2: 121,175,374 L81P probably benign Het
Ubxn2b T A 4: 6,196,404 probably null Het
Usp36 A T 11: 118,265,194 S586T probably benign Het
Vcan T A 13: 89,678,145 D2220V probably damaging Het
Vmn1r173 T A 7: 23,702,791 N150K probably damaging Het
Vmn1r70 G A 7: 10,634,277 A231T probably damaging Het
Vmn2r97 A G 17: 18,947,668 D728G probably damaging Het
Zbtb40 T C 4: 136,983,228 E1200G probably damaging Het
Zfp365 A T 10: 67,897,606 V252D probably damaging Het
Other mutations in Nsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02546:Nsl1 APN 1 191071201 missense probably benign 0.06
IGL03398:Nsl1 APN 1 191082164 splice site probably benign
IGL02988:Nsl1 UTSW 1 191063103 nonsense probably null
R0054:Nsl1 UTSW 1 191082184 missense probably damaging 1.00
R0054:Nsl1 UTSW 1 191082184 missense probably damaging 1.00
R0284:Nsl1 UTSW 1 191065230 missense probably damaging 1.00
R1776:Nsl1 UTSW 1 191063188 missense probably benign
R5187:Nsl1 UTSW 1 191075190 missense probably benign 0.01
R5470:Nsl1 UTSW 1 191080540 missense probably benign 0.24
R5838:Nsl1 UTSW 1 191070113 missense probably benign 0.02
R6133:Nsl1 UTSW 1 191071206 missense probably damaging 0.99
R6636:Nsl1 UTSW 1 191075127 missense probably benign 0.00
R6817:Nsl1 UTSW 1 191063274 critical splice donor site probably null
R7755:Nsl1 UTSW 1 191063183 missense probably benign 0.21
Z1177:Nsl1 UTSW 1 191063231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCTCACATACGTTGTCAAAGTCC -3'
(R):5'- CGGCACTAGCATCTAGTTGCCTTC -3'

Sequencing Primer
(F):5'- TACGTTGTCAAAGTCCGAGGC -3'
(R):5'- ATCGTTCCATCTGCGAAGG -3'
Posted On2013-05-23