Incidental Mutation 'R0482:Gpsm2'
ID42015
Institutional Source Beutler Lab
Gene Symbol Gpsm2
Ensembl Gene ENSMUSG00000027883
Gene NameG-protein signalling modulator 2 (AGS3-like, C. elegans)
SynonymsLGN, 6230410J09Rik, Pins
MMRRC Submission 038682-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R0482 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108678638-108722309 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 108702394 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029482] [ENSMUST00000145558]
Predicted Effect probably benign
Transcript: ENSMUST00000029482
SMART Domains Protein: ENSMUSP00000029482
Gene: ENSMUSG00000027883

DomainStartEndE-ValueType
TPR 62 95 7.86e-3 SMART
TPR 102 135 4.34e-5 SMART
Blast:TPR 142 188 9e-22 BLAST
TPR 202 235 1.69e-2 SMART
TPR 242 275 3.99e-4 SMART
TPR 282 315 1.51e-4 SMART
TPR 322 355 1.04e-2 SMART
GoLoco 490 512 3.69e-9 SMART
low complexity region 518 527 N/A INTRINSIC
GoLoco 543 565 7.27e-8 SMART
GoLoco 594 616 2.31e-10 SMART
GoLoco 628 650 2.75e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124043
Predicted Effect probably benign
Transcript: ENSMUST00000145558
SMART Domains Protein: ENSMUSP00000115759
Gene: ENSMUSG00000027883

DomainStartEndE-ValueType
Blast:TPR 24 57 1e-10 BLAST
Pfam:TPR_8 61 84 1.5e-2 PFAM
Pfam:TPR_10 61 101 3.6e-5 PFAM
Pfam:TPR_1 62 86 7.6e-6 PFAM
Pfam:TPR_2 62 94 2e-5 PFAM
Pfam:TPR_7 64 99 1e-4 PFAM
Pfam:TPR_12 101 154 4.6e-10 PFAM
Pfam:TPR_2 102 134 7e-4 PFAM
Pfam:TPR_1 102 135 2.2e-8 PFAM
Pfam:TPR_8 102 136 5.8e-3 PFAM
Pfam:TPR_7 104 139 4.3e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154263
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of proteins that modulate activation of G proteins, which transduce extracellular signals received by cell surface receptors into integrated cellular responses. The N-terminal half of this protein contains 10 copies of leu-gly-asn (LGN) repeat, and the C-terminal half contains 4 GoLoco motifs, which are involved in guanine nucleotide exchange. This protein may play a role in neuroblast division and in the development of normal hearing. Mutations in this gene are associated with autosomal recessive nonsyndromic deafness (DFNB82). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Targeted disruption of this gene randomizes the spindle orientation of normally planar neuroepithelial divisions. The ensuing loss of the apical membrane from daughter cells frequently converts them into abnormally localized progenitors with no apparent effect on neuronal production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,988,423 probably null Het
Abca13 G A 11: 9,328,207 G3129D possibly damaging Het
Acnat2 T C 4: 49,383,534 I6M probably benign Het
Adcy4 T A 14: 55,774,572 probably null Het
Agrn A G 4: 156,173,555 S1117P probably damaging Het
Anks1b A G 10: 90,359,195 N545S probably benign Het
Antxr1 C T 6: 87,269,238 probably null Het
Arhgef17 T C 7: 100,880,621 K476E probably damaging Het
Bptf T C 11: 107,081,262 S927G probably benign Het
Cacna1s C T 1: 136,113,394 T1286I probably benign Het
Ccdc174 T A 6: 91,895,266 M292K probably benign Het
Cdk5rap2 G A 4: 70,410,269 probably benign Het
Celsr3 T A 9: 108,829,073 Y918* probably null Het
Cep250 T C 2: 155,964,974 probably benign Het
Ces2h A G 8: 105,020,271 D513G possibly damaging Het
Clec2l A G 6: 38,663,392 T53A probably benign Het
Cntnap2 C T 6: 45,715,816 S77L probably benign Het
Cped1 A T 6: 22,016,958 H102L probably benign Het
Crim1 T A 17: 78,372,579 D916E probably benign Het
Csmd1 T A 8: 16,233,101 I614F probably damaging Het
Csnk1g1 G A 9: 66,010,469 E37K probably damaging Het
Ctnnbl1 T A 2: 157,871,190 probably null Het
Cuzd1 A T 7: 131,309,872 probably benign Het
Cyp4f16 T A 17: 32,550,551 V433D probably damaging Het
Ddi1 A G 9: 6,266,144 L75P probably damaging Het
Ddias G A 7: 92,859,528 A393V probably benign Het
Dgka A T 10: 128,734,121 Y123* probably null Het
Dlgap1 T C 17: 70,516,190 C57R probably benign Het
Dysf T A 6: 84,152,405 V1458D probably benign Het
Eif2ak4 T A 2: 118,462,347 Y1230N probably damaging Het
Fam160a2 G A 7: 105,384,212 P599L possibly damaging Het
Fam46a T C 9: 85,325,055 Y230C probably damaging Het
Fbxl7 A T 15: 26,543,546 S338R probably benign Het
Fgf23 A T 6: 127,073,159 T44S probably damaging Het
Folh1 A T 7: 86,746,101 probably benign Het
Hdac2 T A 10: 36,989,134 probably benign Het
Hist1h2bl A G 13: 21,716,125 probably benign Het
Il31ra G T 13: 112,527,481 T446N possibly damaging Het
Irf5 T A 6: 29,535,370 L199H probably benign Het
Kif18a T A 2: 109,287,843 M1K probably null Het
Kif4-ps A C 12: 101,148,662 I1017L probably benign Het
Klhl2 C T 8: 64,758,130 V295M probably benign Het
Krt75 A T 15: 101,570,311 M296K probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lgr4 T C 2: 110,008,092 S439P probably damaging Het
Lhfpl2 C A 13: 94,174,610 N129K probably damaging Het
Lnx2 A G 5: 147,018,961 V675A probably damaging Het
Med13 T C 11: 86,285,151 T1673A probably benign Het
Mif A G 10: 75,860,140 V10A possibly damaging Het
Mki67 A T 7: 135,699,429 I1292N possibly damaging Het
Mylip C A 13: 45,404,583 N89K probably benign Het
Myo19 G T 11: 84,909,419 D877Y probably benign Het
Nckap5 A G 1: 126,026,365 S753P possibly damaging Het
Nlrc3 T C 16: 3,965,192 T118A possibly damaging Het
Nptx2 T C 5: 144,553,459 Y233H probably damaging Het
Nsl1 T A 1: 191,063,040 M1K probably null Het
Ntsr1 T A 2: 180,501,056 S213R possibly damaging Het
Olfr1225 A T 2: 89,170,631 F194I probably benign Het
Olfr48 A G 2: 89,844,169 V268A probably benign Het
Olfr669 T A 7: 104,938,814 F96Y possibly damaging Het
Pde4d G A 13: 109,936,710 V347I probably benign Het
Pik3r4 T A 9: 105,669,045 S865T probably benign Het
Ppp2r2d A G 7: 138,870,431 R136G probably benign Het
Proser2 A C 2: 6,113,910 S41A probably damaging Het
Proz A T 8: 13,073,460 K244* probably null Het
Prpf38b A T 3: 108,905,270 L209H probably damaging Het
R3hdm1 C A 1: 128,184,517 A390E probably benign Het
Rb1cc1 A C 1: 6,240,323 D315A probably damaging Het
Rnf141 G A 7: 110,837,138 R28* probably null Het
Rps6kc1 A T 1: 190,799,430 S792T probably benign Het
Rxrg A G 1: 167,631,037 D233G possibly damaging Het
Sh2d7 A G 9: 54,541,037 N114S probably benign Het
Slc25a38 T C 9: 120,120,833 V205A probably benign Het
Slc4a10 T C 2: 62,297,017 probably benign Het
Spred1 T A 2: 117,152,978 probably null Het
Stt3b A G 9: 115,248,567 S706P probably benign Het
Tcerg1 C A 18: 42,564,240 probably benign Het
Thsd4 A T 9: 60,002,978 I109N probably damaging Het
Ticrr C A 7: 79,694,488 P1367Q probably damaging Het
Trpv1 A G 11: 73,239,429 D146G probably damaging Het
Tubd1 T G 11: 86,557,776 V305G possibly damaging Het
Tubgcp4 T C 2: 121,175,374 L81P probably benign Het
Ubxn2b T A 4: 6,196,404 probably null Het
Usp36 A T 11: 118,265,194 S586T probably benign Het
Vcan T A 13: 89,678,145 D2220V probably damaging Het
Vmn1r173 T A 7: 23,702,791 N150K probably damaging Het
Vmn1r70 G A 7: 10,634,277 A231T probably damaging Het
Vmn2r97 A G 17: 18,947,668 D728G probably damaging Het
Zbtb40 T C 4: 136,983,228 E1200G probably damaging Het
Zfp365 A T 10: 67,897,606 V252D probably damaging Het
Other mutations in Gpsm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Gpsm2 APN 3 108696987 missense probably benign 0.00
IGL01754:Gpsm2 APN 3 108703045 missense probably damaging 1.00
IGL02624:Gpsm2 APN 3 108682033 missense probably benign 0.01
IGL03005:Gpsm2 APN 3 108687006 splice site probably benign
R1793:Gpsm2 UTSW 3 108700909 missense probably benign 0.14
R1796:Gpsm2 UTSW 3 108701850 missense probably damaging 0.99
R4174:Gpsm2 UTSW 3 108702509 missense probably damaging 1.00
R7048:Gpsm2 UTSW 3 108703045 missense probably damaging 1.00
R7325:Gpsm2 UTSW 3 108702928 missense probably damaging 1.00
R7400:Gpsm2 UTSW 3 108679688 missense probably damaging 1.00
R7574:Gpsm2 UTSW 3 108700745 missense probably damaging 0.98
R7657:Gpsm2 UTSW 3 108700745 missense probably damaging 0.98
R7709:Gpsm2 UTSW 3 108701781 missense probably benign 0.08
R8181:Gpsm2 UTSW 3 108689764 critical splice donor site probably null
Z1088:Gpsm2 UTSW 3 108700760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGAAAAGGACGGGTCCCTAGTG -3'
(R):5'- TCTACTTGCATGACTACGCCAAAGC -3'

Sequencing Primer
(F):5'- TAGTGCCCATCCACAGAAAGTC -3'
(R):5'- AACTCTTGCACGGTAATTTCAGC -3'
Posted On2013-05-23