Mutagenetix > Incidental Mutation

Incidental Mutation 'R0482:Cntnap2'

42025

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

5430425M22Rik, Caspr2

MMRRC Submission

038682-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0482 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45059357-47304213 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 45715816 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 77 (S77L)

Ref Sequence

ENSEMBL: ENSMUSP00000147145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641] [ENSMUST00000207647]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114641
AA Change: S77L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: S77L

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000207647
AA Change: S77L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Meta Mutation Damage Score

0.0725

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.8%
20x: 93.4%

Validation Efficiency

95% (94/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	C	17: 8,988,423		probably null	Het
Abca13	G	A	11: 9,328,207	G3129D	possibly damaging	Het
Acnat2	T	C	4: 49,383,534	I6M	probably benign	Het
Adcy4	T	A	14: 55,774,572		probably null	Het
Agrn	A	G	4: 156,173,555	S1117P	probably damaging	Het
Anks1b	A	G	10: 90,359,195	N545S	probably benign	Het
Antxr1	C	T	6: 87,269,238		probably null	Het
Arhgef17	T	C	7: 100,880,621	K476E	probably damaging	Het
Bptf	T	C	11: 107,081,262	S927G	probably benign	Het
Cacna1s	C	T	1: 136,113,394	T1286I	probably benign	Het
Ccdc174	T	A	6: 91,895,266	M292K	probably benign	Het
Cdk5rap2	G	A	4: 70,410,269		probably benign	Het
Celsr3	T	A	9: 108,829,073	Y918*	probably null	Het
Cep250	T	C	2: 155,964,974		probably benign	Het
Ces2h	A	G	8: 105,020,271	D513G	possibly damaging	Het
Clec2l	A	G	6: 38,663,392	T53A	probably benign	Het
Cped1	A	T	6: 22,016,958	H102L	probably benign	Het
Crim1	T	A	17: 78,372,579	D916E	probably benign	Het
Csmd1	T	A	8: 16,233,101	I614F	probably damaging	Het
Csnk1g1	G	A	9: 66,010,469	E37K	probably damaging	Het
Ctnnbl1	T	A	2: 157,871,190		probably null	Het
Cuzd1	A	T	7: 131,309,872		probably benign	Het
Cyp4f16	T	A	17: 32,550,551	V433D	probably damaging	Het
Ddi1	A	G	9: 6,266,144	L75P	probably damaging	Het
Ddias	G	A	7: 92,859,528	A393V	probably benign	Het
Dgka	A	T	10: 128,734,121	Y123*	probably null	Het
Dlgap1	T	C	17: 70,516,190	C57R	probably benign	Het
Dysf	T	A	6: 84,152,405	V1458D	probably benign	Het
Eif2ak4	T	A	2: 118,462,347	Y1230N	probably damaging	Het
Fam160a2	G	A	7: 105,384,212	P599L	possibly damaging	Het
Fam46a	T	C	9: 85,325,055	Y230C	probably damaging	Het
Fbxl7	A	T	15: 26,543,546	S338R	probably benign	Het
Fgf23	A	T	6: 127,073,159	T44S	probably damaging	Het
Folh1	A	T	7: 86,746,101		probably benign	Het
Gpsm2	A	T	3: 108,702,394		probably benign	Het
Hdac2	T	A	10: 36,989,134		probably benign	Het
Hist1h2bl	A	G	13: 21,716,125		probably benign	Het
Il31ra	G	T	13: 112,527,481	T446N	possibly damaging	Het
Irf5	T	A	6: 29,535,370	L199H	probably benign	Het
Kif18a	T	A	2: 109,287,843	M1K	probably null	Het
Kif4-ps	A	C	12: 101,148,662	I1017L	probably benign	Het
Klhl2	C	T	8: 64,758,130	V295M	probably benign	Het
Krt75	A	T	15: 101,570,311	M296K	probably benign	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lgr4	T	C	2: 110,008,092	S439P	probably damaging	Het
Lhfpl2	C	A	13: 94,174,610	N129K	probably damaging	Het
Lnx2	A	G	5: 147,018,961	V675A	probably damaging	Het
Med13	T	C	11: 86,285,151	T1673A	probably benign	Het
Mif	A	G	10: 75,860,140	V10A	possibly damaging	Het
Mki67	A	T	7: 135,699,429	I1292N	possibly damaging	Het
Mylip	C	A	13: 45,404,583	N89K	probably benign	Het
Myo19	G	T	11: 84,909,419	D877Y	probably benign	Het
Nckap5	A	G	1: 126,026,365	S753P	possibly damaging	Het
Nlrc3	T	C	16: 3,965,192	T118A	possibly damaging	Het
Nptx2	T	C	5: 144,553,459	Y233H	probably damaging	Het
Nsl1	T	A	1: 191,063,040	M1K	probably null	Het
Ntsr1	T	A	2: 180,501,056	S213R	possibly damaging	Het
Olfr1225	A	T	2: 89,170,631	F194I	probably benign	Het
Olfr48	A	G	2: 89,844,169	V268A	probably benign	Het
Olfr669	T	A	7: 104,938,814	F96Y	possibly damaging	Het
Pde4d	G	A	13: 109,936,710	V347I	probably benign	Het
Pik3r4	T	A	9: 105,669,045	S865T	probably benign	Het
Ppp2r2d	A	G	7: 138,870,431	R136G	probably benign	Het
Proser2	A	C	2: 6,113,910	S41A	probably damaging	Het
Proz	A	T	8: 13,073,460	K244*	probably null	Het
Prpf38b	A	T	3: 108,905,270	L209H	probably damaging	Het
R3hdm1	C	A	1: 128,184,517	A390E	probably benign	Het
Rb1cc1	A	C	1: 6,240,323	D315A	probably damaging	Het
Rnf141	G	A	7: 110,837,138	R28*	probably null	Het
Rps6kc1	A	T	1: 190,799,430	S792T	probably benign	Het
Rxrg	A	G	1: 167,631,037	D233G	possibly damaging	Het
Sh2d7	A	G	9: 54,541,037	N114S	probably benign	Het
Slc25a38	T	C	9: 120,120,833	V205A	probably benign	Het
Slc4a10	T	C	2: 62,297,017		probably benign	Het
Spred1	T	A	2: 117,152,978		probably null	Het
Stt3b	A	G	9: 115,248,567	S706P	probably benign	Het
Tcerg1	C	A	18: 42,564,240		probably benign	Het
Thsd4	A	T	9: 60,002,978	I109N	probably damaging	Het
Ticrr	C	A	7: 79,694,488	P1367Q	probably damaging	Het
Trpv1	A	G	11: 73,239,429	D146G	probably damaging	Het
Tubd1	T	G	11: 86,557,776	V305G	possibly damaging	Het
Tubgcp4	T	C	2: 121,175,374	L81P	probably benign	Het
Ubxn2b	T	A	4: 6,196,404		probably null	Het
Usp36	A	T	11: 118,265,194	S586T	probably benign	Het
Vcan	T	A	13: 89,678,145	D2220V	probably damaging	Het
Vmn1r173	T	A	7: 23,702,791	N150K	probably damaging	Het
Vmn1r70	G	A	7: 10,634,277	A231T	probably damaging	Het
Vmn2r97	A	G	17: 18,947,668	D728G	probably damaging	Het
Zbtb40	T	C	4: 136,983,228	E1200G	probably damaging	Het
Zfp365	A	T	10: 67,897,606	V252D	probably damaging	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	46015263	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46988787	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47193038	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46484072	missense	probably benign
IGL00857:Cntnap2	APN	6	47049424	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	46015465	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47193013	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47271371	nonsense	probably null
IGL01859:Cntnap2	APN	6	46988721	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46234203	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	47021654	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46234320	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	47021736	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47095549	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46170245	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46530171	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46483983	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45060392	splice site	probably null
R0352:Cntnap2	UTSW	6	45992084	splice site	probably null
R0389:Cntnap2	UTSW	6	46009637	missense	probably benign	0.06
R0530:Cntnap2	UTSW	6	46529905	nonsense	probably null
R0611:Cntnap2	UTSW	6	47095549	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46988760	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47296708	splice site	probably benign
R0976:Cntnap2	UTSW	6	47271230	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1387:Cntnap2	UTSW	6	47107914	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46530679	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	46015330	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47107892	nonsense	probably null
R1757:Cntnap2	UTSW	6	46759829	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46988675	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46530633	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47298588	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47298445	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	46015266	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45991903	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46856128	missense	probably benign
R4030:Cntnap2	UTSW	6	46856128	missense	probably benign
R4237:Cntnap2	UTSW	6	46530390	intron	probably benign
R4445:Cntnap2	UTSW	6	46759851	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46530035	intron	probably benign
R4918:Cntnap2	UTSW	6	46530035	intron	probably benign
R4999:Cntnap2	UTSW	6	45920834	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45920926	nonsense	probably null
R5748:Cntnap2	UTSW	6	45715884	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46529815	intron	probably benign
R6118:Cntnap2	UTSW	6	47193077	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46759808	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47271298	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45060112	splice site	probably null
R6385:Cntnap2	UTSW	6	46856180	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46759760	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46170272	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	46015257	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46988646	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47271271	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46484029	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46347145	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47095693	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46759773	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45992041	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47049222	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	46001227	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46856142	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46484049	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46484205	intron	probably benign
R9209:Cntnap2	UTSW	6	47049249	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	46001178	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	46001347	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	46001310	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46234283	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	46015231	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45992075	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46988792	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	46015439	frame shift	probably null
R9745:Cntnap2	UTSW	6	46234166	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47049327	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	47021665	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	46009518	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	47021754	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46234245	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47271148	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	46015299	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AAGCATAGCTGCATCCGTTTTCCTTA -3'
(R):5'- TGACTCACCCAGATATTGCCATCTTGA -3'

Sequencing Primer
(F):5'- GCTGGAAGAATATTAGTTGAAGTCCC -3'
(R):5'- CCCAGATATTGCCATCTTGATGATAG -3'

Posted On

2013-05-23