Incidental Mutation 'R0482:Dysf'
ID 42026
Institutional Source Beutler Lab
Gene Symbol Dysf
Ensembl Gene ENSMUSG00000033788
Gene Name dysferlin
Synonyms 2310004N10Rik
MMRRC Submission 038682-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0482 (G1)
Quality Score 214
Status Validated
Chromosome 6
Chromosomal Location 83985572-84188042 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84129387 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 1458 (V1458D)
Ref Sequence ENSEMBL: ENSMUSP00000144705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081904] [ENSMUST00000089595] [ENSMUST00000113818] [ENSMUST00000113821] [ENSMUST00000113823] [ENSMUST00000168387] [ENSMUST00000153860] [ENSMUST00000203803] [ENSMUST00000204354] [ENSMUST00000203695] [ENSMUST00000204987] [ENSMUST00000204591]
AlphaFold Q9ESD7
Predicted Effect probably benign
Transcript: ENSMUST00000081904
AA Change: V1489D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080579
Gene: ENSMUSG00000033788
AA Change: V1489D

DomainStartEndE-ValueType
C2 1 101 2.11e-14 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 213 232 N/A INTRINSIC
C2 255 351 4.84e-14 SMART
FerI 337 408 5.3e-39 SMART
C2 414 528 2.96e-9 SMART
FerA 714 779 6.3e-23 SMART
FerB 806 880 2.49e-44 SMART
DysFN 894 953 1.42e-22 SMART
DysFN 966 1022 2.65e-22 SMART
DysFC 1031 1069 1.33e-13 SMART
DysFC 1088 1121 1.1e-10 SMART
C2 1173 1281 2.63e-15 SMART
C2 1350 1457 7.13e0 SMART
C2 1599 1698 2.52e-12 SMART
C2 1832 1961 1.55e-3 SMART
Pfam:Ferlin_C 1991 2095 6.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089595
AA Change: V1472D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087022
Gene: ENSMUSG00000033788
AA Change: V1472D

DomainStartEndE-ValueType
C2 1 101 2.11e-14 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 4.84e-14 SMART
FerI 306 377 5.3e-39 SMART
C2 383 497 1.12e-9 SMART
FerA 697 762 6.3e-23 SMART
FerB 789 863 2.49e-44 SMART
DysFN 877 936 1.42e-22 SMART
DysFN 949 1005 2.65e-22 SMART
DysFC 1014 1052 1.33e-13 SMART
DysFC 1071 1104 1.1e-10 SMART
C2 1156 1264 2.63e-15 SMART
C2 1333 1440 7.13e0 SMART
C2 1582 1681 2.52e-12 SMART
C2 1815 1944 1.55e-3 SMART
Pfam:Ferlin_C 1974 2078 3.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113818
AA Change: V1458D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109449
Gene: ENSMUSG00000033788
AA Change: V1458D

DomainStartEndE-ValueType
C2 1 101 2.11e-14 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 4.84e-14 SMART
FerI 306 377 5.3e-39 SMART
C2 383 497 2.96e-9 SMART
FerA 683 748 6.3e-23 SMART
FerB 775 849 2.49e-44 SMART
DysFN 863 922 1.42e-22 SMART
DysFN 935 991 2.65e-22 SMART
DysFC 1000 1038 1.33e-13 SMART
DysFC 1057 1090 1.1e-10 SMART
C2 1142 1250 2.63e-15 SMART
C2 1319 1426 7.13e0 SMART
C2 1568 1667 2.52e-12 SMART
C2 1801 1930 1.55e-3 SMART
transmembrane domain 2034 2056 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113821
AA Change: V1471D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109452
Gene: ENSMUSG00000033788
AA Change: V1471D

DomainStartEndE-ValueType
C2 1 100 1.62e-15 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
C2 223 319 4.84e-14 SMART
FerI 305 376 5.3e-39 SMART
C2 382 496 1.12e-9 SMART
FerA 696 761 6.3e-23 SMART
FerB 788 862 2.49e-44 SMART
DysFN 876 935 1.42e-22 SMART
DysFN 948 1004 2.65e-22 SMART
DysFC 1013 1051 1.33e-13 SMART
DysFC 1070 1103 1.1e-10 SMART
C2 1155 1263 2.63e-15 SMART
C2 1332 1439 7.13e0 SMART
C2 1581 1680 2.52e-12 SMART
C2 1814 1943 1.55e-3 SMART
transmembrane domain 2047 2069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113823
AA Change: V1488D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109454
Gene: ENSMUSG00000033788
AA Change: V1488D

DomainStartEndE-ValueType
C2 1 100 1.62e-15 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
C2 254 350 4.84e-14 SMART
FerI 336 407 5.3e-39 SMART
C2 413 527 2.96e-9 SMART
FerA 713 778 6.3e-23 SMART
FerB 805 879 2.49e-44 SMART
DysFN 893 952 1.42e-22 SMART
DysFN 965 1021 2.65e-22 SMART
DysFC 1030 1068 1.33e-13 SMART
DysFC 1087 1120 1.1e-10 SMART
C2 1172 1280 2.63e-15 SMART
C2 1349 1456 7.13e0 SMART
C2 1598 1697 2.52e-12 SMART
C2 1831 1960 1.55e-3 SMART
transmembrane domain 2064 2086 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142711
Predicted Effect probably benign
Transcript: ENSMUST00000168387
AA Change: V1479D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132297
Gene: ENSMUSG00000033788
AA Change: V1479D

DomainStartEndE-ValueType
C2 1 100 1.62e-15 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
C2 223 319 4.84e-14 SMART
FerI 305 376 5.3e-39 SMART
C2 382 496 1.12e-9 SMART
FerA 704 769 6.3e-23 SMART
FerB 796 870 2.49e-44 SMART
DysFN 884 943 1.42e-22 SMART
DysFN 956 1012 2.65e-22 SMART
DysFC 1021 1059 1.33e-13 SMART
DysFC 1078 1111 1.1e-10 SMART
C2 1163 1271 2.63e-15 SMART
C2 1340 1447 7.13e0 SMART
C2 1589 1688 2.52e-12 SMART
C2 1822 1951 1.55e-3 SMART
transmembrane domain 2055 2077 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153860
AA Change: V1471D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145518
Gene: ENSMUSG00000033788
AA Change: V1471D

DomainStartEndE-ValueType
C2 1 100 1.1e-17 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
C2 223 319 3.2e-16 SMART
FerI 305 376 2.6e-43 SMART
C2 382 496 7.4e-12 SMART
FerA 696 761 3.1e-27 SMART
FerB 788 862 1.2e-48 SMART
DysFN 876 935 5.3e-25 SMART
DysFN 948 1004 9.6e-25 SMART
DysFC 1013 1051 4.7e-16 SMART
DysFC 1070 1103 4.1e-13 SMART
C2 1155 1263 1.7e-17 SMART
C2 1332 1439 4.7e-2 SMART
C2 1602 1701 1.7e-14 SMART
C2 1835 1964 1.1e-5 SMART
Pfam:Ferlin_C 1994 2098 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203803
AA Change: V1492D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145511
Gene: ENSMUSG00000033788
AA Change: V1492D

DomainStartEndE-ValueType
C2 1 100 1.1e-17 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
C2 254 350 3.2e-16 SMART
FerI 336 407 2.6e-43 SMART
C2 413 527 7.4e-12 SMART
FerA 727 792 3.1e-27 SMART
FerB 819 893 1.2e-48 SMART
DysFN 907 966 5.3e-25 SMART
DysFN 979 1035 9.6e-25 SMART
DysFC 1044 1082 4.7e-16 SMART
DysFC 1101 1134 4.1e-13 SMART
C2 1186 1294 1.7e-17 SMART
C2 1353 1460 4.7e-2 SMART
C2 1602 1701 1.7e-14 SMART
C2 1835 1964 1.1e-5 SMART
Pfam:Ferlin_C 1994 2098 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204354
AA Change: V1458D

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144705
Gene: ENSMUSG00000033788
AA Change: V1458D

DomainStartEndE-ValueType
C2 1 101 1.4e-16 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 3.2e-16 SMART
FerI 306 377 2.6e-43 SMART
C2 383 497 2e-11 SMART
FerA 683 748 3.1e-27 SMART
FerB 775 849 1.2e-48 SMART
DysFN 863 922 5.3e-25 SMART
DysFN 935 991 9.6e-25 SMART
DysFC 1000 1038 4.7e-16 SMART
DysFC 1057 1090 4.1e-13 SMART
C2 1142 1250 1.7e-17 SMART
C2 1319 1426 4.7e-2 SMART
C2 1589 1688 1.7e-14 SMART
C2 1822 1951 1.1e-5 SMART
Pfam:Ferlin_C 1981 2085 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203695
AA Change: V1503D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145292
Gene: ENSMUSG00000033788
AA Change: V1503D

DomainStartEndE-ValueType
C2 1 101 1.4e-16 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 213 232 N/A INTRINSIC
C2 255 351 3.2e-16 SMART
FerI 337 408 2.6e-43 SMART
C2 414 528 7.4e-12 SMART
FerA 728 793 3.1e-27 SMART
FerB 820 894 1.2e-48 SMART
DysFN 908 967 5.3e-25 SMART
DysFN 980 1036 9.6e-25 SMART
DysFC 1045 1083 4.7e-16 SMART
DysFC 1102 1135 4.1e-13 SMART
C2 1187 1295 1.7e-17 SMART
C2 1364 1471 4.7e-2 SMART
C2 1613 1712 1.7e-14 SMART
C2 1846 1975 1.1e-5 SMART
Pfam:Ferlin_C 2005 2109 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204987
AA Change: V1472D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144748
Gene: ENSMUSG00000033788
AA Change: V1472D

DomainStartEndE-ValueType
C2 1 101 1.4e-16 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 3.2e-16 SMART
FerI 306 377 2.6e-43 SMART
C2 383 497 7.4e-12 SMART
FerA 697 762 3.1e-27 SMART
FerB 789 863 1.2e-48 SMART
DysFN 877 936 5.3e-25 SMART
DysFN 949 1005 9.6e-25 SMART
DysFC 1014 1052 4.7e-16 SMART
DysFC 1071 1104 4.1e-13 SMART
C2 1156 1264 1.7e-17 SMART
C2 1333 1440 4.7e-2 SMART
C2 1603 1702 1.7e-14 SMART
C2 1836 1965 1.1e-5 SMART
Pfam:Ferlin_C 1995 2099 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204591
AA Change: V1488D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144970
Gene: ENSMUSG00000033788
AA Change: V1488D

DomainStartEndE-ValueType
C2 1 100 1.1e-17 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
C2 254 350 3.2e-16 SMART
FerI 336 407 2.6e-43 SMART
C2 413 527 2e-11 SMART
FerA 713 778 3.1e-27 SMART
FerB 805 879 1.2e-48 SMART
DysFN 893 952 5.3e-25 SMART
DysFN 965 1021 9.6e-25 SMART
DysFC 1030 1068 4.7e-16 SMART
DysFC 1087 1120 4.1e-13 SMART
C2 1172 1280 1.7e-17 SMART
C2 1349 1456 4.7e-2 SMART
C2 1619 1718 1.7e-14 SMART
C2 1852 1981 1.1e-5 SMART
Pfam:Ferlin_C 2011 2115 4.4e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ferlin family and is a skeletal muscle protein found associated with the sarcolemma. It is involved in muscle contraction and contains C2 domains that play a role in calcium-mediated membrane fusion events, suggesting that it may be involved in membrane regeneration and repair. In addition, the protein encoded by this gene binds caveolin-3, a skeletal muscle membrane protein which is important in the formation of caveolae. Specific mutations in this gene have been shown to cause autosomal recessive limb girdle muscular dystrophy type 2B (LGMD2B) as well as Miyoshi myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes display dystrophic muscle changes and progressive muscle weakness developing over time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,207,255 (GRCm39) probably null Het
Abca13 G A 11: 9,278,207 (GRCm39) G3129D possibly damaging Het
Acnat2 T C 4: 49,383,534 (GRCm39) I6M probably benign Het
Adcy4 T A 14: 56,012,029 (GRCm39) probably null Het
Agrn A G 4: 156,258,012 (GRCm39) S1117P probably damaging Het
Anks1b A G 10: 90,195,057 (GRCm39) N545S probably benign Het
Antxr1 C T 6: 87,246,220 (GRCm39) probably null Het
Arhgef17 T C 7: 100,529,828 (GRCm39) K476E probably damaging Het
Bptf T C 11: 106,972,088 (GRCm39) S927G probably benign Het
Cacna1s C T 1: 136,041,132 (GRCm39) T1286I probably benign Het
Ccdc174 T A 6: 91,872,247 (GRCm39) M292K probably benign Het
Cdk5rap2 G A 4: 70,328,506 (GRCm39) probably benign Het
Celsr3 T A 9: 108,706,272 (GRCm39) Y918* probably null Het
Cep250 T C 2: 155,806,894 (GRCm39) probably benign Het
Ces2h A G 8: 105,746,903 (GRCm39) D513G possibly damaging Het
Clec2l A G 6: 38,640,327 (GRCm39) T53A probably benign Het
Cntnap2 C T 6: 45,692,750 (GRCm39) S77L probably benign Het
Cped1 A T 6: 22,016,957 (GRCm39) H102L probably benign Het
Crim1 T A 17: 78,680,008 (GRCm39) D916E probably benign Het
Csmd1 T A 8: 16,283,115 (GRCm39) I614F probably damaging Het
Csnk1g1 G A 9: 65,917,751 (GRCm39) E37K probably damaging Het
Ctnnbl1 T A 2: 157,713,110 (GRCm39) probably null Het
Cuzd1 A T 7: 130,911,601 (GRCm39) probably benign Het
Cyp4f16 T A 17: 32,769,525 (GRCm39) V433D probably damaging Het
Ddi1 A G 9: 6,266,144 (GRCm39) L75P probably damaging Het
Ddias G A 7: 92,508,736 (GRCm39) A393V probably benign Het
Dgka A T 10: 128,569,990 (GRCm39) Y123* probably null Het
Dlgap1 T C 17: 70,823,185 (GRCm39) C57R probably benign Het
Eif2ak4 T A 2: 118,292,828 (GRCm39) Y1230N probably damaging Het
Fbxl7 A T 15: 26,543,632 (GRCm39) S338R probably benign Het
Fgf23 A T 6: 127,050,122 (GRCm39) T44S probably damaging Het
Fhip1b G A 7: 105,033,419 (GRCm39) P599L possibly damaging Het
Folh1 A T 7: 86,395,309 (GRCm39) probably benign Het
Gpsm2 A T 3: 108,609,710 (GRCm39) probably benign Het
H2bc13 A G 13: 21,900,295 (GRCm39) probably benign Het
Hdac2 T A 10: 36,865,130 (GRCm39) probably benign Het
Il31ra G T 13: 112,664,015 (GRCm39) T446N possibly damaging Het
Irf5 T A 6: 29,535,369 (GRCm39) L199H probably benign Het
Kif18a T A 2: 109,118,188 (GRCm39) M1K probably null Het
Kif4-ps A C 12: 101,114,921 (GRCm39) I1017L probably benign Het
Klhl2 C T 8: 65,211,164 (GRCm39) V295M probably benign Het
Krt75 A T 15: 101,478,746 (GRCm39) M296K probably benign Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Lgr4 T C 2: 109,838,437 (GRCm39) S439P probably damaging Het
Lhfpl2 C A 13: 94,311,118 (GRCm39) N129K probably damaging Het
Lnx2 A G 5: 146,955,771 (GRCm39) V675A probably damaging Het
Med13 T C 11: 86,175,977 (GRCm39) T1673A probably benign Het
Mif A G 10: 75,695,974 (GRCm39) V10A possibly damaging Het
Mki67 A T 7: 135,301,158 (GRCm39) I1292N possibly damaging Het
Mylip C A 13: 45,558,059 (GRCm39) N89K probably benign Het
Myo19 G T 11: 84,800,245 (GRCm39) D877Y probably benign Het
Nckap5 A G 1: 125,954,102 (GRCm39) S753P possibly damaging Het
Nlrc3 T C 16: 3,783,056 (GRCm39) T118A possibly damaging Het
Nptx2 T C 5: 144,490,269 (GRCm39) Y233H probably damaging Het
Nsl1 T A 1: 190,795,237 (GRCm39) M1K probably null Het
Ntsr1 T A 2: 180,142,849 (GRCm39) S213R possibly damaging Het
Or4c120 A T 2: 89,000,975 (GRCm39) F194I probably benign Het
Or4c58 A G 2: 89,674,513 (GRCm39) V268A probably benign Het
Or52n5 T A 7: 104,588,021 (GRCm39) F96Y possibly damaging Het
Pde4d G A 13: 110,073,244 (GRCm39) V347I probably benign Het
Pik3r4 T A 9: 105,546,244 (GRCm39) S865T probably benign Het
Ppp2r2d A G 7: 138,472,160 (GRCm39) R136G probably benign Het
Proser2 A C 2: 6,118,721 (GRCm39) S41A probably damaging Het
Proz A T 8: 13,123,460 (GRCm39) K244* probably null Het
Prpf38b A T 3: 108,812,586 (GRCm39) L209H probably damaging Het
R3hdm1 C A 1: 128,112,254 (GRCm39) A390E probably benign Het
Rb1cc1 A C 1: 6,310,547 (GRCm39) D315A probably damaging Het
Rnf141 G A 7: 110,436,345 (GRCm39) R28* probably null Het
Rps6kc1 A T 1: 190,531,627 (GRCm39) S792T probably benign Het
Rxrg A G 1: 167,458,606 (GRCm39) D233G possibly damaging Het
Sh2d7 A G 9: 54,448,321 (GRCm39) N114S probably benign Het
Slc25a38 T C 9: 119,949,899 (GRCm39) V205A probably benign Het
Slc4a10 T C 2: 62,127,361 (GRCm39) probably benign Het
Spred1 T A 2: 116,983,459 (GRCm39) probably null Het
Stt3b A G 9: 115,077,635 (GRCm39) S706P probably benign Het
Tcerg1 C A 18: 42,697,305 (GRCm39) probably benign Het
Tent5a T C 9: 85,207,108 (GRCm39) Y230C probably damaging Het
Thsd4 A T 9: 59,910,261 (GRCm39) I109N probably damaging Het
Ticrr C A 7: 79,344,236 (GRCm39) P1367Q probably damaging Het
Trpv1 A G 11: 73,130,255 (GRCm39) D146G probably damaging Het
Tubd1 T G 11: 86,448,602 (GRCm39) V305G possibly damaging Het
Tubgcp4 T C 2: 121,005,855 (GRCm39) L81P probably benign Het
Ubxn2b T A 4: 6,196,404 (GRCm39) probably null Het
Usp36 A T 11: 118,156,020 (GRCm39) S586T probably benign Het
Vcan T A 13: 89,826,264 (GRCm39) D2220V probably damaging Het
Vmn1r173 T A 7: 23,402,216 (GRCm39) N150K probably damaging Het
Vmn1r70 G A 7: 10,368,204 (GRCm39) A231T probably damaging Het
Vmn2r97 A G 17: 19,167,930 (GRCm39) D728G probably damaging Het
Zbtb40 T C 4: 136,710,539 (GRCm39) E1200G probably damaging Het
Zfp365 A T 10: 67,733,436 (GRCm39) V252D probably damaging Het
Other mutations in Dysf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Dysf APN 6 84,085,081 (GRCm39) missense probably damaging 1.00
IGL00340:Dysf APN 6 84,118,933 (GRCm39) missense probably benign 0.02
IGL00429:Dysf APN 6 84,166,826 (GRCm39) missense probably damaging 1.00
IGL00465:Dysf APN 6 84,176,830 (GRCm39) critical splice donor site probably null
IGL00800:Dysf APN 6 84,126,980 (GRCm39) missense probably damaging 1.00
IGL01069:Dysf APN 6 84,176,767 (GRCm39) missense possibly damaging 0.94
IGL01094:Dysf APN 6 84,171,368 (GRCm39) missense probably damaging 1.00
IGL01420:Dysf APN 6 84,126,741 (GRCm39) nonsense probably null
IGL01649:Dysf APN 6 84,176,821 (GRCm39) missense probably damaging 1.00
IGL01923:Dysf APN 6 84,187,811 (GRCm39) makesense probably null
IGL01991:Dysf APN 6 84,090,600 (GRCm39) missense probably damaging 1.00
IGL01999:Dysf APN 6 84,090,600 (GRCm39) missense probably damaging 1.00
IGL02002:Dysf APN 6 84,187,769 (GRCm39) splice site probably benign
IGL02136:Dysf APN 6 84,085,149 (GRCm39) missense probably benign 0.43
IGL02318:Dysf APN 6 84,163,446 (GRCm39) missense possibly damaging 0.50
IGL02378:Dysf APN 6 84,088,887 (GRCm39) missense probably damaging 1.00
IGL02404:Dysf APN 6 84,093,043 (GRCm39) missense probably damaging 1.00
IGL02416:Dysf APN 6 84,169,896 (GRCm39) missense possibly damaging 0.92
IGL02535:Dysf APN 6 84,126,679 (GRCm39) missense possibly damaging 0.45
IGL02553:Dysf APN 6 84,107,109 (GRCm39) missense possibly damaging 0.95
IGL02559:Dysf APN 6 84,044,428 (GRCm39) splice site probably benign
IGL02563:Dysf APN 6 84,163,498 (GRCm39) splice site probably benign
IGL02647:Dysf APN 6 84,114,355 (GRCm39) missense probably damaging 1.00
IGL02820:Dysf APN 6 84,077,187 (GRCm39) missense probably damaging 0.99
IGL02858:Dysf APN 6 84,076,471 (GRCm39) missense probably benign 0.01
IGL02860:Dysf APN 6 84,167,880 (GRCm39) critical splice donor site probably null
IGL02861:Dysf APN 6 84,016,519 (GRCm39) missense probably damaging 0.99
IGL03008:Dysf APN 6 84,050,876 (GRCm39) missense probably benign 0.01
IGL03023:Dysf APN 6 84,169,989 (GRCm39) missense probably damaging 1.00
IGL03074:Dysf APN 6 84,165,208 (GRCm39) missense probably benign 0.25
IGL03342:Dysf APN 6 84,167,854 (GRCm39) missense probably benign
PIT4305001:Dysf UTSW 6 84,077,216 (GRCm39) nonsense probably null
R0067:Dysf UTSW 6 84,040,313 (GRCm39) missense possibly damaging 0.58
R0106:Dysf UTSW 6 84,090,318 (GRCm39) missense probably benign 0.07
R0106:Dysf UTSW 6 84,090,318 (GRCm39) missense probably benign 0.07
R0124:Dysf UTSW 6 84,042,084 (GRCm39) splice site probably benign
R0219:Dysf UTSW 6 84,106,443 (GRCm39) splice site probably benign
R0238:Dysf UTSW 6 84,041,461 (GRCm39) nonsense probably null
R0238:Dysf UTSW 6 84,041,461 (GRCm39) nonsense probably null
R0239:Dysf UTSW 6 84,041,461 (GRCm39) nonsense probably null
R0239:Dysf UTSW 6 84,041,461 (GRCm39) nonsense probably null
R0426:Dysf UTSW 6 84,126,739 (GRCm39) missense probably damaging 1.00
R0455:Dysf UTSW 6 84,117,649 (GRCm39) missense probably benign 0.29
R0545:Dysf UTSW 6 84,076,443 (GRCm39) missense probably damaging 0.99
R0625:Dysf UTSW 6 84,088,969 (GRCm39) splice site probably null
R0676:Dysf UTSW 6 84,090,318 (GRCm39) missense probably benign 0.07
R0699:Dysf UTSW 6 84,167,828 (GRCm39) missense probably benign 0.00
R1165:Dysf UTSW 6 84,044,051 (GRCm39) missense probably damaging 0.98
R1455:Dysf UTSW 6 84,090,368 (GRCm39) missense probably benign 0.01
R1582:Dysf UTSW 6 84,074,749 (GRCm39) missense probably damaging 1.00
R1584:Dysf UTSW 6 84,044,029 (GRCm39) missense probably benign 0.04
R1605:Dysf UTSW 6 84,083,923 (GRCm39) missense probably damaging 0.96
R1674:Dysf UTSW 6 84,156,697 (GRCm39) missense probably benign 0.01
R1739:Dysf UTSW 6 84,089,217 (GRCm39) critical splice donor site probably null
R1765:Dysf UTSW 6 84,167,884 (GRCm39) splice site probably null
R1813:Dysf UTSW 6 84,128,906 (GRCm39) missense possibly damaging 0.83
R1900:Dysf UTSW 6 84,016,549 (GRCm39) missense probably damaging 0.97
R1960:Dysf UTSW 6 84,050,885 (GRCm39) missense probably benign 0.12
R2216:Dysf UTSW 6 84,184,227 (GRCm39) splice site probably null
R2242:Dysf UTSW 6 84,163,491 (GRCm39) critical splice donor site probably null
R2243:Dysf UTSW 6 84,163,491 (GRCm39) critical splice donor site probably null
R2245:Dysf UTSW 6 84,163,491 (GRCm39) critical splice donor site probably null
R2246:Dysf UTSW 6 84,163,491 (GRCm39) critical splice donor site probably null
R2280:Dysf UTSW 6 84,041,476 (GRCm39) missense probably damaging 0.99
R2374:Dysf UTSW 6 84,074,711 (GRCm39) missense probably damaging 1.00
R2403:Dysf UTSW 6 84,016,549 (GRCm39) missense possibly damaging 0.84
R2763:Dysf UTSW 6 84,083,914 (GRCm39) missense probably benign 0.00
R2895:Dysf UTSW 6 84,163,491 (GRCm39) critical splice donor site probably null
R2916:Dysf UTSW 6 84,163,491 (GRCm39) critical splice donor site probably null
R2918:Dysf UTSW 6 84,163,491 (GRCm39) critical splice donor site probably null
R3402:Dysf UTSW 6 84,163,491 (GRCm39) critical splice donor site probably null
R3403:Dysf UTSW 6 84,163,491 (GRCm39) critical splice donor site probably null
R3434:Dysf UTSW 6 84,047,870 (GRCm39) missense probably benign 0.00
R3772:Dysf UTSW 6 84,129,333 (GRCm39) missense possibly damaging 0.63
R3781:Dysf UTSW 6 84,163,491 (GRCm39) critical splice donor site probably null
R3789:Dysf UTSW 6 84,163,491 (GRCm39) critical splice donor site probably null
R3822:Dysf UTSW 6 84,184,070 (GRCm39) splice site probably benign
R3918:Dysf UTSW 6 84,163,491 (GRCm39) critical splice donor site probably null
R3919:Dysf UTSW 6 84,163,491 (GRCm39) critical splice donor site probably null
R3939:Dysf UTSW 6 84,163,491 (GRCm39) critical splice donor site probably null
R3942:Dysf UTSW 6 84,163,491 (GRCm39) critical splice donor site probably null
R4177:Dysf UTSW 6 84,044,013 (GRCm39) nonsense probably null
R4179:Dysf UTSW 6 84,163,491 (GRCm39) critical splice donor site probably null
R4180:Dysf UTSW 6 84,163,491 (GRCm39) critical splice donor site probably null
R4299:Dysf UTSW 6 84,045,059 (GRCm39) missense possibly damaging 0.78
R4419:Dysf UTSW 6 84,184,224 (GRCm39) critical splice donor site probably null
R4446:Dysf UTSW 6 84,182,854 (GRCm39) missense probably damaging 1.00
R4577:Dysf UTSW 6 84,114,308 (GRCm39) missense probably damaging 1.00
R4680:Dysf UTSW 6 84,074,697 (GRCm39) missense probably damaging 0.99
R4708:Dysf UTSW 6 84,074,697 (GRCm39) missense probably damaging 0.99
R4709:Dysf UTSW 6 84,074,697 (GRCm39) missense probably damaging 0.99
R4710:Dysf UTSW 6 84,074,697 (GRCm39) missense probably damaging 0.99
R4725:Dysf UTSW 6 84,074,738 (GRCm39) missense probably damaging 1.00
R4742:Dysf UTSW 6 84,074,697 (GRCm39) missense probably damaging 0.99
R4743:Dysf UTSW 6 84,074,697 (GRCm39) missense probably damaging 0.99
R4749:Dysf UTSW 6 84,043,990 (GRCm39) missense probably damaging 1.00
R4787:Dysf UTSW 6 84,180,310 (GRCm39) nonsense probably null
R4850:Dysf UTSW 6 84,074,697 (GRCm39) missense probably damaging 0.99
R4868:Dysf UTSW 6 84,156,675 (GRCm39) missense probably damaging 1.00
R4871:Dysf UTSW 6 84,044,005 (GRCm39) missense possibly damaging 0.93
R4951:Dysf UTSW 6 84,091,102 (GRCm39) critical splice donor site probably null
R4952:Dysf UTSW 6 84,126,968 (GRCm39) missense possibly damaging 0.79
R5009:Dysf UTSW 6 84,128,968 (GRCm39) missense probably damaging 1.00
R5072:Dysf UTSW 6 84,114,254 (GRCm39) missense probably damaging 1.00
R5073:Dysf UTSW 6 84,114,254 (GRCm39) missense probably damaging 1.00
R5074:Dysf UTSW 6 84,114,254 (GRCm39) missense probably damaging 1.00
R5252:Dysf UTSW 6 84,163,450 (GRCm39) missense probably damaging 0.98
R5260:Dysf UTSW 6 84,127,016 (GRCm39) missense probably damaging 1.00
R5447:Dysf UTSW 6 84,172,245 (GRCm39) missense probably damaging 0.98
R5501:Dysf UTSW 6 84,064,800 (GRCm39) missense probably damaging 0.99
R5533:Dysf UTSW 6 84,163,453 (GRCm39) missense probably damaging 0.99
R5611:Dysf UTSW 6 84,041,860 (GRCm39) missense probably damaging 0.98
R5618:Dysf UTSW 6 84,083,806 (GRCm39) missense probably benign 0.03
R5884:Dysf UTSW 6 84,163,063 (GRCm39) missense probably damaging 1.00
R5927:Dysf UTSW 6 84,184,194 (GRCm39) missense probably damaging 1.00
R6045:Dysf UTSW 6 84,091,054 (GRCm39) missense probably damaging 0.99
R6056:Dysf UTSW 6 84,083,844 (GRCm39) missense probably benign
R6084:Dysf UTSW 6 83,996,586 (GRCm39) missense probably damaging 0.98
R6084:Dysf UTSW 6 84,089,101 (GRCm39) missense probably damaging 1.00
R6146:Dysf UTSW 6 84,180,181 (GRCm39) missense probably damaging 0.96
R6220:Dysf UTSW 6 84,126,727 (GRCm39) missense probably damaging 0.97
R6232:Dysf UTSW 6 84,075,235 (GRCm39) missense probably benign 0.26
R6247:Dysf UTSW 6 84,043,981 (GRCm39) missense probably damaging 1.00
R6298:Dysf UTSW 6 84,084,118 (GRCm39) splice site probably null
R6306:Dysf UTSW 6 84,114,248 (GRCm39) missense possibly damaging 0.91
R6377:Dysf UTSW 6 83,985,945 (GRCm39) missense probably benign
R6415:Dysf UTSW 6 84,117,024 (GRCm39) missense probably damaging 1.00
R6444:Dysf UTSW 6 84,167,822 (GRCm39) missense probably benign 0.36
R6470:Dysf UTSW 6 84,043,926 (GRCm39) missense possibly damaging 0.93
R6504:Dysf UTSW 6 83,985,907 (GRCm39) missense probably benign 0.03
R6557:Dysf UTSW 6 84,163,366 (GRCm39) missense probably damaging 0.99
R6665:Dysf UTSW 6 84,107,098 (GRCm39) missense probably benign
R6701:Dysf UTSW 6 84,089,172 (GRCm39) missense probably damaging 1.00
R6776:Dysf UTSW 6 84,041,876 (GRCm39) missense possibly damaging 0.88
R6909:Dysf UTSW 6 84,169,920 (GRCm39) missense probably damaging 1.00
R7007:Dysf UTSW 6 84,090,962 (GRCm39) missense probably damaging 1.00
R7013:Dysf UTSW 6 84,114,340 (GRCm39) missense probably damaging 1.00
R7035:Dysf UTSW 6 84,163,374 (GRCm39) missense probably benign 0.02
R7094:Dysf UTSW 6 84,077,184 (GRCm39) missense probably benign 0.43
R7124:Dysf UTSW 6 84,167,883 (GRCm39) splice site probably null
R7156:Dysf UTSW 6 84,064,858 (GRCm39) critical splice donor site probably null
R7261:Dysf UTSW 6 84,169,992 (GRCm39) missense probably damaging 0.98
R7296:Dysf UTSW 6 84,083,880 (GRCm39) missense probably benign 0.33
R7356:Dysf UTSW 6 84,044,443 (GRCm39) missense probably damaging 1.00
R7359:Dysf UTSW 6 84,172,306 (GRCm39) splice site probably null
R7384:Dysf UTSW 6 84,091,087 (GRCm39) missense probably benign 0.17
R7409:Dysf UTSW 6 84,126,664 (GRCm39) missense probably benign 0.00
R7449:Dysf UTSW 6 84,114,362 (GRCm39) missense possibly damaging 0.90
R7476:Dysf UTSW 6 84,041,878 (GRCm39) missense probably benign 0.08
R7496:Dysf UTSW 6 84,044,460 (GRCm39) missense probably benign 0.43
R7573:Dysf UTSW 6 84,107,104 (GRCm39) missense possibly damaging 0.59
R7616:Dysf UTSW 6 84,078,945 (GRCm39) missense probably benign 0.01
R7684:Dysf UTSW 6 84,077,117 (GRCm39) missense probably benign 0.00
R7808:Dysf UTSW 6 84,047,911 (GRCm39) missense possibly damaging 0.86
R7836:Dysf UTSW 6 84,114,380 (GRCm39) missense probably damaging 1.00
R7868:Dysf UTSW 6 84,091,081 (GRCm39) missense probably benign 0.00
R7873:Dysf UTSW 6 84,060,747 (GRCm39) missense probably benign
R7956:Dysf UTSW 6 83,985,978 (GRCm39) missense probably benign 0.01
R8130:Dysf UTSW 6 84,114,358 (GRCm39) missense probably damaging 0.97
R8357:Dysf UTSW 6 84,165,227 (GRCm39) missense probably benign 0.01
R8383:Dysf UTSW 6 83,996,565 (GRCm39) missense probably damaging 1.00
R8457:Dysf UTSW 6 84,165,227 (GRCm39) missense probably benign 0.01
R8693:Dysf UTSW 6 84,088,952 (GRCm39) missense probably damaging 1.00
R8738:Dysf UTSW 6 84,171,353 (GRCm39) missense probably damaging 1.00
R8808:Dysf UTSW 6 83,996,466 (GRCm39) start gained probably benign
R8836:Dysf UTSW 6 84,093,105 (GRCm39) missense probably damaging 1.00
R8915:Dysf UTSW 6 84,156,736 (GRCm39) missense probably benign
R8959:Dysf UTSW 6 84,078,945 (GRCm39) missense probably benign 0.01
R9091:Dysf UTSW 6 84,077,216 (GRCm39) nonsense probably null
R9095:Dysf UTSW 6 84,156,666 (GRCm39) missense probably benign 0.01
R9162:Dysf UTSW 6 84,089,215 (GRCm39) missense probably damaging 1.00
R9164:Dysf UTSW 6 84,180,308 (GRCm39) missense probably damaging 1.00
R9166:Dysf UTSW 6 84,126,959 (GRCm39) missense probably damaging 1.00
R9173:Dysf UTSW 6 84,171,379 (GRCm39) missense probably benign 0.10
R9191:Dysf UTSW 6 84,045,048 (GRCm39) missense probably benign 0.43
R9270:Dysf UTSW 6 84,077,216 (GRCm39) nonsense probably null
R9328:Dysf UTSW 6 84,050,895 (GRCm39) missense probably damaging 1.00
R9470:Dysf UTSW 6 84,090,352 (GRCm39) missense possibly damaging 0.59
R9509:Dysf UTSW 6 84,187,779 (GRCm39) missense probably damaging 0.98
R9511:Dysf UTSW 6 84,090,650 (GRCm39) missense probably damaging 1.00
R9526:Dysf UTSW 6 84,128,885 (GRCm39) missense probably damaging 0.99
R9751:Dysf UTSW 6 84,163,450 (GRCm39) missense probably damaging 0.98
X0063:Dysf UTSW 6 84,040,336 (GRCm39) missense probably damaging 0.97
X0066:Dysf UTSW 6 84,091,084 (GRCm39) missense possibly damaging 0.77
Z1176:Dysf UTSW 6 84,049,667 (GRCm39) missense probably damaging 1.00
Z1177:Dysf UTSW 6 84,064,799 (GRCm39) missense probably benign 0.39
Z1177:Dysf UTSW 6 84,041,505 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GACAGAAACTCCTCTGCCAGTGTG -3'
(R):5'- TGCCAAGCATGAGATCAGCGAC -3'

Sequencing Primer
(F):5'- CTGCCAGTGTGAGGGGAG -3'
(R):5'- TGCAGCCATAAGGTAGATGTTCC -3'
Posted On 2013-05-23