Incidental Mutation 'R0482:Ddias'
ID42034
Institutional Source Beutler Lab
Gene Symbol Ddias
Ensembl Gene ENSMUSG00000030641
Gene NameDNA damage-induced apoptosis suppressor
Synonymsnoxin, 4632434I11Rik
MMRRC Submission 038682-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0482 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location92857525-92874247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 92859528 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 393 (A393V)
Ref Sequence ENSEMBL: ENSMUSP00000032877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032877] [ENSMUST00000208356] [ENSMUST00000209074]
Predicted Effect probably benign
Transcript: ENSMUST00000032877
AA Change: A393V

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032877
Gene: ENSMUSG00000030641
AA Change: A393V

DomainStartEndE-ValueType
Pfam:Rep_fac-A_C 7 118 2.1e-14 PFAM
low complexity region 197 209 N/A INTRINSIC
low complexity region 242 253 N/A INTRINSIC
low complexity region 727 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208356
Predicted Effect probably benign
Transcript: ENSMUST00000209074
Meta Mutation Damage Score 0.0816 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 95% (94/99)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,988,423 probably null Het
Abca13 G A 11: 9,328,207 G3129D possibly damaging Het
Acnat2 T C 4: 49,383,534 I6M probably benign Het
Adcy4 T A 14: 55,774,572 probably null Het
Agrn A G 4: 156,173,555 S1117P probably damaging Het
Anks1b A G 10: 90,359,195 N545S probably benign Het
Antxr1 C T 6: 87,269,238 probably null Het
Arhgef17 T C 7: 100,880,621 K476E probably damaging Het
Bptf T C 11: 107,081,262 S927G probably benign Het
Cacna1s C T 1: 136,113,394 T1286I probably benign Het
Ccdc174 T A 6: 91,895,266 M292K probably benign Het
Cdk5rap2 G A 4: 70,410,269 probably benign Het
Celsr3 T A 9: 108,829,073 Y918* probably null Het
Cep250 T C 2: 155,964,974 probably benign Het
Ces2h A G 8: 105,020,271 D513G possibly damaging Het
Clec2l A G 6: 38,663,392 T53A probably benign Het
Cntnap2 C T 6: 45,715,816 S77L probably benign Het
Cped1 A T 6: 22,016,958 H102L probably benign Het
Crim1 T A 17: 78,372,579 D916E probably benign Het
Csmd1 T A 8: 16,233,101 I614F probably damaging Het
Csnk1g1 G A 9: 66,010,469 E37K probably damaging Het
Ctnnbl1 T A 2: 157,871,190 probably null Het
Cuzd1 A T 7: 131,309,872 probably benign Het
Cyp4f16 T A 17: 32,550,551 V433D probably damaging Het
Ddi1 A G 9: 6,266,144 L75P probably damaging Het
Dgka A T 10: 128,734,121 Y123* probably null Het
Dlgap1 T C 17: 70,516,190 C57R probably benign Het
Dysf T A 6: 84,152,405 V1458D probably benign Het
Eif2ak4 T A 2: 118,462,347 Y1230N probably damaging Het
Fam160a2 G A 7: 105,384,212 P599L possibly damaging Het
Fam46a T C 9: 85,325,055 Y230C probably damaging Het
Fbxl7 A T 15: 26,543,546 S338R probably benign Het
Fgf23 A T 6: 127,073,159 T44S probably damaging Het
Folh1 A T 7: 86,746,101 probably benign Het
Gpsm2 A T 3: 108,702,394 probably benign Het
Hdac2 T A 10: 36,989,134 probably benign Het
Hist1h2bl A G 13: 21,716,125 probably benign Het
Il31ra G T 13: 112,527,481 T446N possibly damaging Het
Irf5 T A 6: 29,535,370 L199H probably benign Het
Kif18a T A 2: 109,287,843 M1K probably null Het
Kif4-ps A C 12: 101,148,662 I1017L probably benign Het
Klhl2 C T 8: 64,758,130 V295M probably benign Het
Krt75 A T 15: 101,570,311 M296K probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lgr4 T C 2: 110,008,092 S439P probably damaging Het
Lhfpl2 C A 13: 94,174,610 N129K probably damaging Het
Lnx2 A G 5: 147,018,961 V675A probably damaging Het
Med13 T C 11: 86,285,151 T1673A probably benign Het
Mif A G 10: 75,860,140 V10A possibly damaging Het
Mki67 A T 7: 135,699,429 I1292N possibly damaging Het
Mylip C A 13: 45,404,583 N89K probably benign Het
Myo19 G T 11: 84,909,419 D877Y probably benign Het
Nckap5 A G 1: 126,026,365 S753P possibly damaging Het
Nlrc3 T C 16: 3,965,192 T118A possibly damaging Het
Nptx2 T C 5: 144,553,459 Y233H probably damaging Het
Nsl1 T A 1: 191,063,040 M1K probably null Het
Ntsr1 T A 2: 180,501,056 S213R possibly damaging Het
Olfr1225 A T 2: 89,170,631 F194I probably benign Het
Olfr48 A G 2: 89,844,169 V268A probably benign Het
Olfr669 T A 7: 104,938,814 F96Y possibly damaging Het
Pde4d G A 13: 109,936,710 V347I probably benign Het
Pik3r4 T A 9: 105,669,045 S865T probably benign Het
Ppp2r2d A G 7: 138,870,431 R136G probably benign Het
Proser2 A C 2: 6,113,910 S41A probably damaging Het
Proz A T 8: 13,073,460 K244* probably null Het
Prpf38b A T 3: 108,905,270 L209H probably damaging Het
R3hdm1 C A 1: 128,184,517 A390E probably benign Het
Rb1cc1 A C 1: 6,240,323 D315A probably damaging Het
Rnf141 G A 7: 110,837,138 R28* probably null Het
Rps6kc1 A T 1: 190,799,430 S792T probably benign Het
Rxrg A G 1: 167,631,037 D233G possibly damaging Het
Sh2d7 A G 9: 54,541,037 N114S probably benign Het
Slc25a38 T C 9: 120,120,833 V205A probably benign Het
Slc4a10 T C 2: 62,297,017 probably benign Het
Spred1 T A 2: 117,152,978 probably null Het
Stt3b A G 9: 115,248,567 S706P probably benign Het
Tcerg1 C A 18: 42,564,240 probably benign Het
Thsd4 A T 9: 60,002,978 I109N probably damaging Het
Ticrr C A 7: 79,694,488 P1367Q probably damaging Het
Trpv1 A G 11: 73,239,429 D146G probably damaging Het
Tubd1 T G 11: 86,557,776 V305G possibly damaging Het
Tubgcp4 T C 2: 121,175,374 L81P probably benign Het
Ubxn2b T A 4: 6,196,404 probably null Het
Usp36 A T 11: 118,265,194 S586T probably benign Het
Vcan T A 13: 89,678,145 D2220V probably damaging Het
Vmn1r173 T A 7: 23,702,791 N150K probably damaging Het
Vmn1r70 G A 7: 10,634,277 A231T probably damaging Het
Vmn2r97 A G 17: 18,947,668 D728G probably damaging Het
Zbtb40 T C 4: 136,983,228 E1200G probably damaging Het
Zfp365 A T 10: 67,897,606 V252D probably damaging Het
Other mutations in Ddias
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02727:Ddias APN 7 92866622 missense probably damaging 0.98
IGL02820:Ddias APN 7 92859343 missense probably benign 0.07
I0000:Ddias UTSW 7 92866640 missense possibly damaging 0.69
R0094:Ddias UTSW 7 92859900 missense possibly damaging 0.61
R0883:Ddias UTSW 7 92859337 missense probably benign
R1131:Ddias UTSW 7 92859886 missense possibly damaging 0.92
R1722:Ddias UTSW 7 92860042 missense possibly damaging 0.63
R1758:Ddias UTSW 7 92859363 missense probably benign 0.03
R1937:Ddias UTSW 7 92858622 missense probably benign 0.07
R2067:Ddias UTSW 7 92859699 missense possibly damaging 0.79
R2124:Ddias UTSW 7 92858256 missense probably benign 0.00
R2483:Ddias UTSW 7 92859592 missense probably benign 0.13
R3623:Ddias UTSW 7 92859592 missense probably benign 0.13
R3690:Ddias UTSW 7 92860158 missense probably benign 0.24
R4015:Ddias UTSW 7 92859861 missense probably benign 0.06
R4021:Ddias UTSW 7 92861478 missense possibly damaging 0.57
R4022:Ddias UTSW 7 92861478 missense possibly damaging 0.57
R4384:Ddias UTSW 7 92858223 missense probably damaging 0.98
R4410:Ddias UTSW 7 92858079 missense probably benign 0.04
R4691:Ddias UTSW 7 92858816 missense probably damaging 0.99
R5653:Ddias UTSW 7 92858729 missense probably damaging 1.00
R6666:Ddias UTSW 7 92858081 missense probably benign
R6853:Ddias UTSW 7 92859565 missense possibly damaging 0.46
R7650:Ddias UTSW 7 92858935 missense probably benign 0.00
X0027:Ddias UTSW 7 92858995 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTACTACCGGCTATGGAGACAGC -3'
(R):5'- GCTTACCGAGTCCAGTTTGCAACAG -3'

Sequencing Primer
(F):5'- TATGGAGACAGCCGCTTCTG -3'
(R):5'- GCCATGAAAGTAGATTGTCTGACTC -3'
Posted On2013-05-23