Incidental Mutation 'R0482:Olfr669'
ID42036
Institutional Source Beutler Lab
Gene Symbol Olfr669
Ensembl Gene ENSMUSG00000073916
Gene Nameolfactory receptor 669
SynonymsMOR34-6, GA_x6K02T2PBJ9-7567376-7568329
MMRRC Submission 038682-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R0482 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104934240-104940477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104938814 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 96 (F96Y)
Ref Sequence ENSEMBL: ENSMUSP00000150928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098164] [ENSMUST00000210138] [ENSMUST00000214260]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098164
AA Change: F96Y

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095767
Gene: ENSMUSG00000073916
AA Change: F96Y

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 8.7e-103 PFAM
Pfam:7TM_GPCR_Srsx 37 209 1.9e-10 PFAM
Pfam:7tm_1 43 295 2.7e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000210138
AA Change: F96Y

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211559
Predicted Effect possibly damaging
Transcript: ENSMUST00000214260
AA Change: F96Y

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.2076 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,988,423 probably null Het
Abca13 G A 11: 9,328,207 G3129D possibly damaging Het
Acnat2 T C 4: 49,383,534 I6M probably benign Het
Adcy4 T A 14: 55,774,572 probably null Het
Agrn A G 4: 156,173,555 S1117P probably damaging Het
Anks1b A G 10: 90,359,195 N545S probably benign Het
Antxr1 C T 6: 87,269,238 probably null Het
Arhgef17 T C 7: 100,880,621 K476E probably damaging Het
Bptf T C 11: 107,081,262 S927G probably benign Het
Cacna1s C T 1: 136,113,394 T1286I probably benign Het
Ccdc174 T A 6: 91,895,266 M292K probably benign Het
Cdk5rap2 G A 4: 70,410,269 probably benign Het
Celsr3 T A 9: 108,829,073 Y918* probably null Het
Cep250 T C 2: 155,964,974 probably benign Het
Ces2h A G 8: 105,020,271 D513G possibly damaging Het
Clec2l A G 6: 38,663,392 T53A probably benign Het
Cntnap2 C T 6: 45,715,816 S77L probably benign Het
Cped1 A T 6: 22,016,958 H102L probably benign Het
Crim1 T A 17: 78,372,579 D916E probably benign Het
Csmd1 T A 8: 16,233,101 I614F probably damaging Het
Csnk1g1 G A 9: 66,010,469 E37K probably damaging Het
Ctnnbl1 T A 2: 157,871,190 probably null Het
Cuzd1 A T 7: 131,309,872 probably benign Het
Cyp4f16 T A 17: 32,550,551 V433D probably damaging Het
Ddi1 A G 9: 6,266,144 L75P probably damaging Het
Ddias G A 7: 92,859,528 A393V probably benign Het
Dgka A T 10: 128,734,121 Y123* probably null Het
Dlgap1 T C 17: 70,516,190 C57R probably benign Het
Dysf T A 6: 84,152,405 V1458D probably benign Het
Eif2ak4 T A 2: 118,462,347 Y1230N probably damaging Het
Fam160a2 G A 7: 105,384,212 P599L possibly damaging Het
Fam46a T C 9: 85,325,055 Y230C probably damaging Het
Fbxl7 A T 15: 26,543,546 S338R probably benign Het
Fgf23 A T 6: 127,073,159 T44S probably damaging Het
Folh1 A T 7: 86,746,101 probably benign Het
Gpsm2 A T 3: 108,702,394 probably benign Het
Hdac2 T A 10: 36,989,134 probably benign Het
Hist1h2bl A G 13: 21,716,125 probably benign Het
Il31ra G T 13: 112,527,481 T446N possibly damaging Het
Irf5 T A 6: 29,535,370 L199H probably benign Het
Kif18a T A 2: 109,287,843 M1K probably null Het
Kif4-ps A C 12: 101,148,662 I1017L probably benign Het
Klhl2 C T 8: 64,758,130 V295M probably benign Het
Krt75 A T 15: 101,570,311 M296K probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lgr4 T C 2: 110,008,092 S439P probably damaging Het
Lhfpl2 C A 13: 94,174,610 N129K probably damaging Het
Lnx2 A G 5: 147,018,961 V675A probably damaging Het
Med13 T C 11: 86,285,151 T1673A probably benign Het
Mif A G 10: 75,860,140 V10A possibly damaging Het
Mki67 A T 7: 135,699,429 I1292N possibly damaging Het
Mylip C A 13: 45,404,583 N89K probably benign Het
Myo19 G T 11: 84,909,419 D877Y probably benign Het
Nckap5 A G 1: 126,026,365 S753P possibly damaging Het
Nlrc3 T C 16: 3,965,192 T118A possibly damaging Het
Nptx2 T C 5: 144,553,459 Y233H probably damaging Het
Nsl1 T A 1: 191,063,040 M1K probably null Het
Ntsr1 T A 2: 180,501,056 S213R possibly damaging Het
Olfr1225 A T 2: 89,170,631 F194I probably benign Het
Olfr48 A G 2: 89,844,169 V268A probably benign Het
Pde4d G A 13: 109,936,710 V347I probably benign Het
Pik3r4 T A 9: 105,669,045 S865T probably benign Het
Ppp2r2d A G 7: 138,870,431 R136G probably benign Het
Proser2 A C 2: 6,113,910 S41A probably damaging Het
Proz A T 8: 13,073,460 K244* probably null Het
Prpf38b A T 3: 108,905,270 L209H probably damaging Het
R3hdm1 C A 1: 128,184,517 A390E probably benign Het
Rb1cc1 A C 1: 6,240,323 D315A probably damaging Het
Rnf141 G A 7: 110,837,138 R28* probably null Het
Rps6kc1 A T 1: 190,799,430 S792T probably benign Het
Rxrg A G 1: 167,631,037 D233G possibly damaging Het
Sh2d7 A G 9: 54,541,037 N114S probably benign Het
Slc25a38 T C 9: 120,120,833 V205A probably benign Het
Slc4a10 T C 2: 62,297,017 probably benign Het
Spred1 T A 2: 117,152,978 probably null Het
Stt3b A G 9: 115,248,567 S706P probably benign Het
Tcerg1 C A 18: 42,564,240 probably benign Het
Thsd4 A T 9: 60,002,978 I109N probably damaging Het
Ticrr C A 7: 79,694,488 P1367Q probably damaging Het
Trpv1 A G 11: 73,239,429 D146G probably damaging Het
Tubd1 T G 11: 86,557,776 V305G possibly damaging Het
Tubgcp4 T C 2: 121,175,374 L81P probably benign Het
Ubxn2b T A 4: 6,196,404 probably null Het
Usp36 A T 11: 118,265,194 S586T probably benign Het
Vcan T A 13: 89,678,145 D2220V probably damaging Het
Vmn1r173 T A 7: 23,702,791 N150K probably damaging Het
Vmn1r70 G A 7: 10,634,277 A231T probably damaging Het
Vmn2r97 A G 17: 18,947,668 D728G probably damaging Het
Zbtb40 T C 4: 136,983,228 E1200G probably damaging Het
Zfp365 A T 10: 67,897,606 V252D probably damaging Het
Other mutations in Olfr669
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Olfr669 APN 7 104938991 missense possibly damaging 0.88
IGL01677:Olfr669 APN 7 104938645 missense probably benign 0.01
IGL01900:Olfr669 APN 7 104939162 missense probably damaging 1.00
IGL02270:Olfr669 APN 7 104939369 missense possibly damaging 0.95
R0970:Olfr669 UTSW 7 104939077 missense probably benign 0.05
R4260:Olfr669 UTSW 7 104938596 missense probably damaging 0.99
R4845:Olfr669 UTSW 7 104939363 missense possibly damaging 0.95
R4947:Olfr669 UTSW 7 104938742 missense possibly damaging 0.95
R5438:Olfr669 UTSW 7 104939137 missense probably benign 0.03
R5735:Olfr669 UTSW 7 104938759 missense probably benign 0.01
R5943:Olfr669 UTSW 7 104938643 missense possibly damaging 0.78
R6435:Olfr669 UTSW 7 104938834 missense probably damaging 0.99
R6942:Olfr669 UTSW 7 104938897 missense possibly damaging 0.56
R7061:Olfr669 UTSW 7 104938676 missense probably damaging 1.00
R7122:Olfr669 UTSW 7 104939198 missense probably damaging 0.99
R7378:Olfr669 UTSW 7 104939431 missense probably benign 0.31
R7898:Olfr669 UTSW 7 104939366 missense probably damaging 1.00
R8260:Olfr669 UTSW 7 104938672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCTCCCTAGTAGGCAACCTTGG -3'
(R):5'- TTGCTTCGGCAGAAGGGCAAAC -3'

Sequencing Primer
(F):5'- AGTAGGCAACCTTGGCCTTG -3'
(R):5'- TAACACACCTCTCAAGAAGGTGG -3'
Posted On2013-05-23