Incidental Mutation 'R0482:Dgka'
ID42058
Institutional Source Beutler Lab
Gene Symbol Dgka
Ensembl Gene ENSMUSG00000025357
Gene Namediacylglycerol kinase, alpha
SynonymsDagk1
MMRRC Submission 038682-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R0482 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128720134-128744855 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 128734121 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 123 (Y123*)
Ref Sequence ENSEMBL: ENSMUSP00000152021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026414] [ENSMUST00000219834]
Predicted Effect probably null
Transcript: ENSMUST00000026414
AA Change: Y123*
SMART Domains Protein: ENSMUSP00000026414
Gene: ENSMUSG00000025357
AA Change: Y123*

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 4 93 6.9e-31 PFAM
EFh 115 143 3.82e0 SMART
EFh 160 188 1.29e-4 SMART
C1 207 254 2.29e-10 SMART
C1 269 320 6.91e-5 SMART
DAGKc 372 495 3.11e-62 SMART
DAGKa 515 696 4.1e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217957
Predicted Effect probably null
Transcript: ENSMUST00000219834
AA Change: Y123*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Alternative splicing occurs at this locus and four transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired induction of T cell anergy. T cells stimulated in anergy producing conditions show increased proliferation and interleukin 2 production. Mice homozygous for a transgenic gene disruption exhibit male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,988,423 probably null Het
Abca13 G A 11: 9,328,207 G3129D possibly damaging Het
Acnat2 T C 4: 49,383,534 I6M probably benign Het
Adcy4 T A 14: 55,774,572 probably null Het
Agrn A G 4: 156,173,555 S1117P probably damaging Het
Anks1b A G 10: 90,359,195 N545S probably benign Het
Antxr1 C T 6: 87,269,238 probably null Het
Arhgef17 T C 7: 100,880,621 K476E probably damaging Het
Bptf T C 11: 107,081,262 S927G probably benign Het
Cacna1s C T 1: 136,113,394 T1286I probably benign Het
Ccdc174 T A 6: 91,895,266 M292K probably benign Het
Cdk5rap2 G A 4: 70,410,269 probably benign Het
Celsr3 T A 9: 108,829,073 Y918* probably null Het
Cep250 T C 2: 155,964,974 probably benign Het
Ces2h A G 8: 105,020,271 D513G possibly damaging Het
Clec2l A G 6: 38,663,392 T53A probably benign Het
Cntnap2 C T 6: 45,715,816 S77L probably benign Het
Cped1 A T 6: 22,016,958 H102L probably benign Het
Crim1 T A 17: 78,372,579 D916E probably benign Het
Csmd1 T A 8: 16,233,101 I614F probably damaging Het
Csnk1g1 G A 9: 66,010,469 E37K probably damaging Het
Ctnnbl1 T A 2: 157,871,190 probably null Het
Cuzd1 A T 7: 131,309,872 probably benign Het
Cyp4f16 T A 17: 32,550,551 V433D probably damaging Het
Ddi1 A G 9: 6,266,144 L75P probably damaging Het
Ddias G A 7: 92,859,528 A393V probably benign Het
Dlgap1 T C 17: 70,516,190 C57R probably benign Het
Dysf T A 6: 84,152,405 V1458D probably benign Het
Eif2ak4 T A 2: 118,462,347 Y1230N probably damaging Het
Fam160a2 G A 7: 105,384,212 P599L possibly damaging Het
Fam46a T C 9: 85,325,055 Y230C probably damaging Het
Fbxl7 A T 15: 26,543,546 S338R probably benign Het
Fgf23 A T 6: 127,073,159 T44S probably damaging Het
Folh1 A T 7: 86,746,101 probably benign Het
Gpsm2 A T 3: 108,702,394 probably benign Het
Hdac2 T A 10: 36,989,134 probably benign Het
Hist1h2bl A G 13: 21,716,125 probably benign Het
Il31ra G T 13: 112,527,481 T446N possibly damaging Het
Irf5 T A 6: 29,535,370 L199H probably benign Het
Kif18a T A 2: 109,287,843 M1K probably null Het
Kif4-ps A C 12: 101,148,662 I1017L probably benign Het
Klhl2 C T 8: 64,758,130 V295M probably benign Het
Krt75 A T 15: 101,570,311 M296K probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lgr4 T C 2: 110,008,092 S439P probably damaging Het
Lhfpl2 C A 13: 94,174,610 N129K probably damaging Het
Lnx2 A G 5: 147,018,961 V675A probably damaging Het
Med13 T C 11: 86,285,151 T1673A probably benign Het
Mif A G 10: 75,860,140 V10A possibly damaging Het
Mki67 A T 7: 135,699,429 I1292N possibly damaging Het
Mylip C A 13: 45,404,583 N89K probably benign Het
Myo19 G T 11: 84,909,419 D877Y probably benign Het
Nckap5 A G 1: 126,026,365 S753P possibly damaging Het
Nlrc3 T C 16: 3,965,192 T118A possibly damaging Het
Nptx2 T C 5: 144,553,459 Y233H probably damaging Het
Nsl1 T A 1: 191,063,040 M1K probably null Het
Ntsr1 T A 2: 180,501,056 S213R possibly damaging Het
Olfr1225 A T 2: 89,170,631 F194I probably benign Het
Olfr48 A G 2: 89,844,169 V268A probably benign Het
Olfr669 T A 7: 104,938,814 F96Y possibly damaging Het
Pde4d G A 13: 109,936,710 V347I probably benign Het
Pik3r4 T A 9: 105,669,045 S865T probably benign Het
Ppp2r2d A G 7: 138,870,431 R136G probably benign Het
Proser2 A C 2: 6,113,910 S41A probably damaging Het
Proz A T 8: 13,073,460 K244* probably null Het
Prpf38b A T 3: 108,905,270 L209H probably damaging Het
R3hdm1 C A 1: 128,184,517 A390E probably benign Het
Rb1cc1 A C 1: 6,240,323 D315A probably damaging Het
Rnf141 G A 7: 110,837,138 R28* probably null Het
Rps6kc1 A T 1: 190,799,430 S792T probably benign Het
Rxrg A G 1: 167,631,037 D233G possibly damaging Het
Sh2d7 A G 9: 54,541,037 N114S probably benign Het
Slc25a38 T C 9: 120,120,833 V205A probably benign Het
Slc4a10 T C 2: 62,297,017 probably benign Het
Spred1 T A 2: 117,152,978 probably null Het
Stt3b A G 9: 115,248,567 S706P probably benign Het
Tcerg1 C A 18: 42,564,240 probably benign Het
Thsd4 A T 9: 60,002,978 I109N probably damaging Het
Ticrr C A 7: 79,694,488 P1367Q probably damaging Het
Trpv1 A G 11: 73,239,429 D146G probably damaging Het
Tubd1 T G 11: 86,557,776 V305G possibly damaging Het
Tubgcp4 T C 2: 121,175,374 L81P probably benign Het
Ubxn2b T A 4: 6,196,404 probably null Het
Usp36 A T 11: 118,265,194 S586T probably benign Het
Vcan T A 13: 89,678,145 D2220V probably damaging Het
Vmn1r173 T A 7: 23,702,791 N150K probably damaging Het
Vmn1r70 G A 7: 10,634,277 A231T probably damaging Het
Vmn2r97 A G 17: 18,947,668 D728G probably damaging Het
Zbtb40 T C 4: 136,983,228 E1200G probably damaging Het
Zfp365 A T 10: 67,897,606 V252D probably damaging Het
Other mutations in Dgka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dgka APN 10 128733086 missense probably damaging 1.00
IGL02479:Dgka APN 10 128730246 missense probably benign 0.01
IGL02727:Dgka APN 10 128722448 splice site probably benign
IGL02817:Dgka APN 10 128730228 missense probably benign
IGL02882:Dgka APN 10 128733384 missense possibly damaging 0.77
IGL03239:Dgka APN 10 128721385 splice site probably benign
R0321:Dgka UTSW 10 128721083 splice site probably benign
R0374:Dgka UTSW 10 128721083 splice site probably benign
R0494:Dgka UTSW 10 128721083 splice site probably benign
R0573:Dgka UTSW 10 128737007 critical splice donor site probably null
R0594:Dgka UTSW 10 128733110 splice site probably benign
R0607:Dgka UTSW 10 128720469 unclassified probably null
R0618:Dgka UTSW 10 128721083 splice site probably benign
R0691:Dgka UTSW 10 128723260 splice site probably benign
R1378:Dgka UTSW 10 128735827 splice site probably null
R1424:Dgka UTSW 10 128733333 missense possibly damaging 0.57
R1955:Dgka UTSW 10 128730189 critical splice donor site probably null
R1972:Dgka UTSW 10 128720466 missense probably damaging 0.99
R1998:Dgka UTSW 10 128729939 missense probably benign 0.00
R2046:Dgka UTSW 10 128723535 missense probably damaging 1.00
R4206:Dgka UTSW 10 128721195 missense probably damaging 1.00
R4418:Dgka UTSW 10 128728094 missense probably damaging 1.00
R4752:Dgka UTSW 10 128736659 missense probably benign 0.03
R5092:Dgka UTSW 10 128735833 missense probably damaging 0.99
R5479:Dgka UTSW 10 128729672 critical splice acceptor site probably null
R6009:Dgka UTSW 10 128723679 missense probably damaging 1.00
R6273:Dgka UTSW 10 128723646 missense probably benign 0.03
R6852:Dgka UTSW 10 128722539 missense probably damaging 1.00
R6947:Dgka UTSW 10 128733015 missense probably damaging 1.00
R6973:Dgka UTSW 10 128729594 splice site probably null
R7024:Dgka UTSW 10 128720487 missense probably damaging 1.00
R7076:Dgka UTSW 10 128733583 missense probably damaging 0.99
R7290:Dgka UTSW 10 128733599 missense probably damaging 0.99
R7397:Dgka UTSW 10 128720725 missense possibly damaging 0.95
R7823:Dgka UTSW 10 128736266 missense probably benign 0.00
R7856:Dgka UTSW 10 128736664 missense probably benign
R8118:Dgka UTSW 10 128722449 splice site probably null
X0020:Dgka UTSW 10 128721317 missense probably damaging 1.00
Z1177:Dgka UTSW 10 128720468 missense probably benign 0.00
Z1177:Dgka UTSW 10 128731165 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCTGGATTCCACTTCCAGAATCACC -3'
(R):5'- tctccagccTGTCAGTCCTATTCC -3'

Sequencing Primer
(F):5'- agttttagggatgaacccaagg -3'
(R):5'- gcagggcctcactatgac -3'
Posted On2013-05-23