Incidental Mutation 'R0482:Myo19'
ID 42061
Institutional Source Beutler Lab
Gene Symbol Myo19
Ensembl Gene ENSMUSG00000020527
Gene Name myosin XIX
Synonyms Myohd1, 1110055A02Rik
MMRRC Submission 038682-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.144) question?
Stock # R0482 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 84770996-84802052 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 84800245 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 877 (D877Y)
Ref Sequence ENSEMBL: ENSMUSP00000091502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093969] [ENSMUST00000103195]
AlphaFold Q5SV80
Predicted Effect probably benign
Transcript: ENSMUST00000093969
AA Change: D877Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000091502
Gene: ENSMUSG00000020527
AA Change: D877Y

DomainStartEndE-ValueType
MYSc 29 759 4.07e-219 SMART
IQ 760 782 1.74e1 SMART
IQ 783 804 1.97e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103195
SMART Domains Protein: ENSMUSP00000099484
Gene: ENSMUSG00000020526

DomainStartEndE-ValueType
Pfam:zf-HIT 7 36 9.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141705
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 95% (94/99)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,207,255 (GRCm39) probably null Het
Abca13 G A 11: 9,278,207 (GRCm39) G3129D possibly damaging Het
Acnat2 T C 4: 49,383,534 (GRCm39) I6M probably benign Het
Adcy4 T A 14: 56,012,029 (GRCm39) probably null Het
Agrn A G 4: 156,258,012 (GRCm39) S1117P probably damaging Het
Anks1b A G 10: 90,195,057 (GRCm39) N545S probably benign Het
Antxr1 C T 6: 87,246,220 (GRCm39) probably null Het
Arhgef17 T C 7: 100,529,828 (GRCm39) K476E probably damaging Het
Bptf T C 11: 106,972,088 (GRCm39) S927G probably benign Het
Cacna1s C T 1: 136,041,132 (GRCm39) T1286I probably benign Het
Ccdc174 T A 6: 91,872,247 (GRCm39) M292K probably benign Het
Cdk5rap2 G A 4: 70,328,506 (GRCm39) probably benign Het
Celsr3 T A 9: 108,706,272 (GRCm39) Y918* probably null Het
Cep250 T C 2: 155,806,894 (GRCm39) probably benign Het
Ces2h A G 8: 105,746,903 (GRCm39) D513G possibly damaging Het
Clec2l A G 6: 38,640,327 (GRCm39) T53A probably benign Het
Cntnap2 C T 6: 45,692,750 (GRCm39) S77L probably benign Het
Cped1 A T 6: 22,016,957 (GRCm39) H102L probably benign Het
Crim1 T A 17: 78,680,008 (GRCm39) D916E probably benign Het
Csmd1 T A 8: 16,283,115 (GRCm39) I614F probably damaging Het
Csnk1g1 G A 9: 65,917,751 (GRCm39) E37K probably damaging Het
Ctnnbl1 T A 2: 157,713,110 (GRCm39) probably null Het
Cuzd1 A T 7: 130,911,601 (GRCm39) probably benign Het
Cyp4f16 T A 17: 32,769,525 (GRCm39) V433D probably damaging Het
Ddi1 A G 9: 6,266,144 (GRCm39) L75P probably damaging Het
Ddias G A 7: 92,508,736 (GRCm39) A393V probably benign Het
Dgka A T 10: 128,569,990 (GRCm39) Y123* probably null Het
Dlgap1 T C 17: 70,823,185 (GRCm39) C57R probably benign Het
Dysf T A 6: 84,129,387 (GRCm39) V1458D probably benign Het
Eif2ak4 T A 2: 118,292,828 (GRCm39) Y1230N probably damaging Het
Fbxl7 A T 15: 26,543,632 (GRCm39) S338R probably benign Het
Fgf23 A T 6: 127,050,122 (GRCm39) T44S probably damaging Het
Fhip1b G A 7: 105,033,419 (GRCm39) P599L possibly damaging Het
Folh1 A T 7: 86,395,309 (GRCm39) probably benign Het
Gpsm2 A T 3: 108,609,710 (GRCm39) probably benign Het
H2bc13 A G 13: 21,900,295 (GRCm39) probably benign Het
Hdac2 T A 10: 36,865,130 (GRCm39) probably benign Het
Il31ra G T 13: 112,664,015 (GRCm39) T446N possibly damaging Het
Irf5 T A 6: 29,535,369 (GRCm39) L199H probably benign Het
Kif18a T A 2: 109,118,188 (GRCm39) M1K probably null Het
Kif4-ps A C 12: 101,114,921 (GRCm39) I1017L probably benign Het
Klhl2 C T 8: 65,211,164 (GRCm39) V295M probably benign Het
Krt75 A T 15: 101,478,746 (GRCm39) M296K probably benign Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Lgr4 T C 2: 109,838,437 (GRCm39) S439P probably damaging Het
Lhfpl2 C A 13: 94,311,118 (GRCm39) N129K probably damaging Het
Lnx2 A G 5: 146,955,771 (GRCm39) V675A probably damaging Het
Med13 T C 11: 86,175,977 (GRCm39) T1673A probably benign Het
Mif A G 10: 75,695,974 (GRCm39) V10A possibly damaging Het
Mki67 A T 7: 135,301,158 (GRCm39) I1292N possibly damaging Het
Mylip C A 13: 45,558,059 (GRCm39) N89K probably benign Het
Nckap5 A G 1: 125,954,102 (GRCm39) S753P possibly damaging Het
Nlrc3 T C 16: 3,783,056 (GRCm39) T118A possibly damaging Het
Nptx2 T C 5: 144,490,269 (GRCm39) Y233H probably damaging Het
Nsl1 T A 1: 190,795,237 (GRCm39) M1K probably null Het
Ntsr1 T A 2: 180,142,849 (GRCm39) S213R possibly damaging Het
Or4c120 A T 2: 89,000,975 (GRCm39) F194I probably benign Het
Or4c58 A G 2: 89,674,513 (GRCm39) V268A probably benign Het
Or52n5 T A 7: 104,588,021 (GRCm39) F96Y possibly damaging Het
Pde4d G A 13: 110,073,244 (GRCm39) V347I probably benign Het
Pik3r4 T A 9: 105,546,244 (GRCm39) S865T probably benign Het
Ppp2r2d A G 7: 138,472,160 (GRCm39) R136G probably benign Het
Proser2 A C 2: 6,118,721 (GRCm39) S41A probably damaging Het
Proz A T 8: 13,123,460 (GRCm39) K244* probably null Het
Prpf38b A T 3: 108,812,586 (GRCm39) L209H probably damaging Het
R3hdm1 C A 1: 128,112,254 (GRCm39) A390E probably benign Het
Rb1cc1 A C 1: 6,310,547 (GRCm39) D315A probably damaging Het
Rnf141 G A 7: 110,436,345 (GRCm39) R28* probably null Het
Rps6kc1 A T 1: 190,531,627 (GRCm39) S792T probably benign Het
Rxrg A G 1: 167,458,606 (GRCm39) D233G possibly damaging Het
Sh2d7 A G 9: 54,448,321 (GRCm39) N114S probably benign Het
Slc25a38 T C 9: 119,949,899 (GRCm39) V205A probably benign Het
Slc4a10 T C 2: 62,127,361 (GRCm39) probably benign Het
Spred1 T A 2: 116,983,459 (GRCm39) probably null Het
Stt3b A G 9: 115,077,635 (GRCm39) S706P probably benign Het
Tcerg1 C A 18: 42,697,305 (GRCm39) probably benign Het
Tent5a T C 9: 85,207,108 (GRCm39) Y230C probably damaging Het
Thsd4 A T 9: 59,910,261 (GRCm39) I109N probably damaging Het
Ticrr C A 7: 79,344,236 (GRCm39) P1367Q probably damaging Het
Trpv1 A G 11: 73,130,255 (GRCm39) D146G probably damaging Het
Tubd1 T G 11: 86,448,602 (GRCm39) V305G possibly damaging Het
Tubgcp4 T C 2: 121,005,855 (GRCm39) L81P probably benign Het
Ubxn2b T A 4: 6,196,404 (GRCm39) probably null Het
Usp36 A T 11: 118,156,020 (GRCm39) S586T probably benign Het
Vcan T A 13: 89,826,264 (GRCm39) D2220V probably damaging Het
Vmn1r173 T A 7: 23,402,216 (GRCm39) N150K probably damaging Het
Vmn1r70 G A 7: 10,368,204 (GRCm39) A231T probably damaging Het
Vmn2r97 A G 17: 19,167,930 (GRCm39) D728G probably damaging Het
Zbtb40 T C 4: 136,710,539 (GRCm39) E1200G probably damaging Het
Zfp365 A T 10: 67,733,436 (GRCm39) V252D probably damaging Het
Other mutations in Myo19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Myo19 APN 11 84,800,324 (GRCm39) missense probably benign 0.00
IGL01120:Myo19 APN 11 84,798,104 (GRCm39) missense probably damaging 0.96
IGL01542:Myo19 APN 11 84,800,372 (GRCm39) missense probably damaging 0.96
IGL02341:Myo19 APN 11 84,778,871 (GRCm39) splice site probably benign
IGL02708:Myo19 APN 11 84,790,222 (GRCm39) missense possibly damaging 0.89
IGL03223:Myo19 APN 11 84,801,297 (GRCm39) missense possibly damaging 0.57
BB004:Myo19 UTSW 11 84,791,046 (GRCm39) missense probably damaging 1.00
BB014:Myo19 UTSW 11 84,791,046 (GRCm39) missense probably damaging 1.00
R0009:Myo19 UTSW 11 84,778,995 (GRCm39) critical splice donor site probably null
R0125:Myo19 UTSW 11 84,779,001 (GRCm39) splice site probably benign
R0142:Myo19 UTSW 11 84,785,429 (GRCm39) missense probably damaging 1.00
R0226:Myo19 UTSW 11 84,788,558 (GRCm39) splice site probably benign
R0230:Myo19 UTSW 11 84,784,159 (GRCm39) missense possibly damaging 0.91
R1981:Myo19 UTSW 11 84,782,996 (GRCm39) missense possibly damaging 0.46
R2035:Myo19 UTSW 11 84,788,434 (GRCm39) missense probably benign
R2185:Myo19 UTSW 11 84,783,047 (GRCm39) missense probably benign 0.00
R3176:Myo19 UTSW 11 84,783,001 (GRCm39) missense probably benign 0.01
R3276:Myo19 UTSW 11 84,783,001 (GRCm39) missense probably benign 0.01
R3824:Myo19 UTSW 11 84,776,505 (GRCm39) missense probably damaging 0.98
R3914:Myo19 UTSW 11 84,785,429 (GRCm39) missense probably damaging 1.00
R4333:Myo19 UTSW 11 84,799,114 (GRCm39) missense probably benign 0.00
R4335:Myo19 UTSW 11 84,799,114 (GRCm39) missense probably benign 0.00
R4647:Myo19 UTSW 11 84,785,468 (GRCm39) missense probably damaging 1.00
R4968:Myo19 UTSW 11 84,792,328 (GRCm39) missense probably damaging 1.00
R4971:Myo19 UTSW 11 84,783,023 (GRCm39) missense probably damaging 1.00
R5083:Myo19 UTSW 11 84,794,037 (GRCm39) missense possibly damaging 0.60
R5284:Myo19 UTSW 11 84,776,098 (GRCm39) splice site probably null
R5558:Myo19 UTSW 11 84,801,274 (GRCm39) missense probably damaging 1.00
R5739:Myo19 UTSW 11 84,788,450 (GRCm39) missense probably damaging 1.00
R5982:Myo19 UTSW 11 84,790,226 (GRCm39) missense probably damaging 0.97
R6093:Myo19 UTSW 11 84,776,535 (GRCm39) missense probably damaging 1.00
R6444:Myo19 UTSW 11 84,786,134 (GRCm39) missense probably benign
R6657:Myo19 UTSW 11 84,788,022 (GRCm39) missense probably benign
R6945:Myo19 UTSW 11 84,788,386 (GRCm39) missense probably benign 0.06
R7022:Myo19 UTSW 11 84,791,373 (GRCm39) missense probably damaging 0.99
R7058:Myo19 UTSW 11 84,798,194 (GRCm39) missense possibly damaging 0.89
R7150:Myo19 UTSW 11 84,796,439 (GRCm39) missense probably benign
R7155:Myo19 UTSW 11 84,791,412 (GRCm39) missense probably damaging 1.00
R7478:Myo19 UTSW 11 84,776,626 (GRCm39) missense probably benign 0.41
R7486:Myo19 UTSW 11 84,796,463 (GRCm39) missense probably benign
R7833:Myo19 UTSW 11 84,800,093 (GRCm39) missense probably benign
R7921:Myo19 UTSW 11 84,799,064 (GRCm39) missense possibly damaging 0.55
R7923:Myo19 UTSW 11 84,776,536 (GRCm39) missense possibly damaging 0.87
R7927:Myo19 UTSW 11 84,791,046 (GRCm39) missense probably damaging 1.00
R9105:Myo19 UTSW 11 84,794,029 (GRCm39) missense probably damaging 0.99
R9714:Myo19 UTSW 11 84,773,542 (GRCm39) start codon destroyed probably null 0.18
X0053:Myo19 UTSW 11 84,788,541 (GRCm39) nonsense probably null
Z1176:Myo19 UTSW 11 84,800,176 (GRCm39) frame shift probably null
Z1176:Myo19 UTSW 11 84,776,104 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GATCAGAATGGCCTGTCTTGCCTC -3'
(R):5'- AGGAAGTCTTTTGCTGCTCCAAGC -3'

Sequencing Primer
(F):5'- CTTGCCTCTAAAGAACTGGATGG -3'
(R):5'- TCTCAGTGAACAGTTCGGAG -3'
Posted On 2013-05-23