Incidental Mutation 'R0482:Med13'
ID42062
Institutional Source Beutler Lab
Gene Symbol Med13
Ensembl Gene ENSMUSG00000034297
Gene Namemediator complex subunit 13
SynonymsThrap1, 1110067M05Rik, Trap240
MMRRC Submission 038682-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R0482 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location86267033-86357602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86285151 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1673 (T1673A)
Ref Sequence ENSEMBL: ENSMUSP00000044268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043624]
Predicted Effect probably benign
Transcript: ENSMUST00000043624
AA Change: T1673A

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: T1673A

DomainStartEndE-ValueType
Pfam:Med13_N 1 384 5e-130 PFAM
low complexity region 438 451 N/A INTRINSIC
low complexity region 531 540 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 984 998 N/A INTRINSIC
low complexity region 1001 1029 N/A INTRINSIC
low complexity region 1463 1476 N/A INTRINSIC
low complexity region 1502 1517 N/A INTRINSIC
low complexity region 1522 1550 N/A INTRINSIC
low complexity region 1559 1570 N/A INTRINSIC
low complexity region 1577 1596 N/A INTRINSIC
Pfam:Med13_C 1637 2161 3.5e-146 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Meta Mutation Damage Score 0.0711 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,988,423 probably null Het
Abca13 G A 11: 9,328,207 G3129D possibly damaging Het
Acnat2 T C 4: 49,383,534 I6M probably benign Het
Adcy4 T A 14: 55,774,572 probably null Het
Agrn A G 4: 156,173,555 S1117P probably damaging Het
Anks1b A G 10: 90,359,195 N545S probably benign Het
Antxr1 C T 6: 87,269,238 probably null Het
Arhgef17 T C 7: 100,880,621 K476E probably damaging Het
Bptf T C 11: 107,081,262 S927G probably benign Het
Cacna1s C T 1: 136,113,394 T1286I probably benign Het
Ccdc174 T A 6: 91,895,266 M292K probably benign Het
Cdk5rap2 G A 4: 70,410,269 probably benign Het
Celsr3 T A 9: 108,829,073 Y918* probably null Het
Cep250 T C 2: 155,964,974 probably benign Het
Ces2h A G 8: 105,020,271 D513G possibly damaging Het
Clec2l A G 6: 38,663,392 T53A probably benign Het
Cntnap2 C T 6: 45,715,816 S77L probably benign Het
Cped1 A T 6: 22,016,958 H102L probably benign Het
Crim1 T A 17: 78,372,579 D916E probably benign Het
Csmd1 T A 8: 16,233,101 I614F probably damaging Het
Csnk1g1 G A 9: 66,010,469 E37K probably damaging Het
Ctnnbl1 T A 2: 157,871,190 probably null Het
Cuzd1 A T 7: 131,309,872 probably benign Het
Cyp4f16 T A 17: 32,550,551 V433D probably damaging Het
Ddi1 A G 9: 6,266,144 L75P probably damaging Het
Ddias G A 7: 92,859,528 A393V probably benign Het
Dgka A T 10: 128,734,121 Y123* probably null Het
Dlgap1 T C 17: 70,516,190 C57R probably benign Het
Dysf T A 6: 84,152,405 V1458D probably benign Het
Eif2ak4 T A 2: 118,462,347 Y1230N probably damaging Het
Fam160a2 G A 7: 105,384,212 P599L possibly damaging Het
Fam46a T C 9: 85,325,055 Y230C probably damaging Het
Fbxl7 A T 15: 26,543,546 S338R probably benign Het
Fgf23 A T 6: 127,073,159 T44S probably damaging Het
Folh1 A T 7: 86,746,101 probably benign Het
Gpsm2 A T 3: 108,702,394 probably benign Het
Hdac2 T A 10: 36,989,134 probably benign Het
Hist1h2bl A G 13: 21,716,125 probably benign Het
Il31ra G T 13: 112,527,481 T446N possibly damaging Het
Irf5 T A 6: 29,535,370 L199H probably benign Het
Kif18a T A 2: 109,287,843 M1K probably null Het
Kif4-ps A C 12: 101,148,662 I1017L probably benign Het
Klhl2 C T 8: 64,758,130 V295M probably benign Het
Krt75 A T 15: 101,570,311 M296K probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lgr4 T C 2: 110,008,092 S439P probably damaging Het
Lhfpl2 C A 13: 94,174,610 N129K probably damaging Het
Lnx2 A G 5: 147,018,961 V675A probably damaging Het
Mif A G 10: 75,860,140 V10A possibly damaging Het
Mki67 A T 7: 135,699,429 I1292N possibly damaging Het
Mylip C A 13: 45,404,583 N89K probably benign Het
Myo19 G T 11: 84,909,419 D877Y probably benign Het
Nckap5 A G 1: 126,026,365 S753P possibly damaging Het
Nlrc3 T C 16: 3,965,192 T118A possibly damaging Het
Nptx2 T C 5: 144,553,459 Y233H probably damaging Het
Nsl1 T A 1: 191,063,040 M1K probably null Het
Ntsr1 T A 2: 180,501,056 S213R possibly damaging Het
Olfr1225 A T 2: 89,170,631 F194I probably benign Het
Olfr48 A G 2: 89,844,169 V268A probably benign Het
Olfr669 T A 7: 104,938,814 F96Y possibly damaging Het
Pde4d G A 13: 109,936,710 V347I probably benign Het
Pik3r4 T A 9: 105,669,045 S865T probably benign Het
Ppp2r2d A G 7: 138,870,431 R136G probably benign Het
Proser2 A C 2: 6,113,910 S41A probably damaging Het
Proz A T 8: 13,073,460 K244* probably null Het
Prpf38b A T 3: 108,905,270 L209H probably damaging Het
R3hdm1 C A 1: 128,184,517 A390E probably benign Het
Rb1cc1 A C 1: 6,240,323 D315A probably damaging Het
Rnf141 G A 7: 110,837,138 R28* probably null Het
Rps6kc1 A T 1: 190,799,430 S792T probably benign Het
Rxrg A G 1: 167,631,037 D233G possibly damaging Het
Sh2d7 A G 9: 54,541,037 N114S probably benign Het
Slc25a38 T C 9: 120,120,833 V205A probably benign Het
Slc4a10 T C 2: 62,297,017 probably benign Het
Spred1 T A 2: 117,152,978 probably null Het
Stt3b A G 9: 115,248,567 S706P probably benign Het
Tcerg1 C A 18: 42,564,240 probably benign Het
Thsd4 A T 9: 60,002,978 I109N probably damaging Het
Ticrr C A 7: 79,694,488 P1367Q probably damaging Het
Trpv1 A G 11: 73,239,429 D146G probably damaging Het
Tubd1 T G 11: 86,557,776 V305G possibly damaging Het
Tubgcp4 T C 2: 121,175,374 L81P probably benign Het
Ubxn2b T A 4: 6,196,404 probably null Het
Usp36 A T 11: 118,265,194 S586T probably benign Het
Vcan T A 13: 89,678,145 D2220V probably damaging Het
Vmn1r173 T A 7: 23,702,791 N150K probably damaging Het
Vmn1r70 G A 7: 10,634,277 A231T probably damaging Het
Vmn2r97 A G 17: 18,947,668 D728G probably damaging Het
Zbtb40 T C 4: 136,983,228 E1200G probably damaging Het
Zfp365 A T 10: 67,897,606 V252D probably damaging Het
Other mutations in Med13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Med13 APN 11 86291040 splice site probably benign
IGL01391:Med13 APN 11 86328497 missense probably benign
IGL01767:Med13 APN 11 86319783 missense probably benign 0.38
IGL01830:Med13 APN 11 86288928 splice site probably benign
IGL01859:Med13 APN 11 86283751 missense possibly damaging 0.86
IGL01924:Med13 APN 11 86308696 splice site probably benign
IGL02080:Med13 APN 11 86283812 missense probably damaging 0.97
IGL02138:Med13 APN 11 86286765 missense probably damaging 0.99
IGL02259:Med13 APN 11 86357501 missense possibly damaging 0.89
IGL02339:Med13 APN 11 86288939 missense probably benign 0.16
IGL02399:Med13 APN 11 86283945 splice site probably benign
IGL02646:Med13 APN 11 86283386 missense probably benign 0.00
IGL03227:Med13 APN 11 86327792 splice site probably benign
R0116:Med13 UTSW 11 86319897 missense probably damaging 0.99
R0189:Med13 UTSW 11 86319876 missense probably benign
R0197:Med13 UTSW 11 86307038 missense probably benign 0.13
R0206:Med13 UTSW 11 86300856 splice site probably benign
R0208:Med13 UTSW 11 86300856 splice site probably benign
R0310:Med13 UTSW 11 86346003 missense probably benign 0.11
R0360:Med13 UTSW 11 86329161 splice site probably benign
R0413:Med13 UTSW 11 86299207 splice site probably benign
R0497:Med13 UTSW 11 86276983 splice site probably benign
R0589:Med13 UTSW 11 86283249 missense probably damaging 1.00
R0601:Med13 UTSW 11 86345962 missense possibly damaging 0.47
R0646:Med13 UTSW 11 86331089 missense possibly damaging 0.95
R0701:Med13 UTSW 11 86307038 missense probably benign 0.13
R0709:Med13 UTSW 11 86319596 missense possibly damaging 0.95
R0711:Med13 UTSW 11 86301353 splice site probably benign
R0734:Med13 UTSW 11 86301237 missense probably benign
R0883:Med13 UTSW 11 86307038 missense probably benign 0.13
R1793:Med13 UTSW 11 86329351 missense probably benign 0.45
R1926:Med13 UTSW 11 86289073 missense possibly damaging 0.47
R1959:Med13 UTSW 11 86298979 missense probably damaging 1.00
R2286:Med13 UTSW 11 86319689 missense probably benign 0.05
R2359:Med13 UTSW 11 86291035 splice site probably benign
R2444:Med13 UTSW 11 86331960 missense probably damaging 1.00
R2679:Med13 UTSW 11 86298577 missense probably benign 0.00
R2879:Med13 UTSW 11 86299162 missense possibly damaging 0.61
R3439:Med13 UTSW 11 86285297 missense probably damaging 1.00
R3735:Med13 UTSW 11 86279658 missense probably benign 0.00
R4333:Med13 UTSW 11 86288183 missense probably benign
R4558:Med13 UTSW 11 86299054 missense probably damaging 1.00
R4598:Med13 UTSW 11 86278566 missense probably damaging 0.97
R4773:Med13 UTSW 11 86276920 missense probably damaging 0.99
R4801:Med13 UTSW 11 86278773 missense probably damaging 1.00
R4802:Med13 UTSW 11 86278773 missense probably damaging 1.00
R4806:Med13 UTSW 11 86298577 missense probably benign 0.00
R4940:Med13 UTSW 11 86288118 missense probably damaging 1.00
R4974:Med13 UTSW 11 86298847 missense probably damaging 0.98
R5056:Med13 UTSW 11 86328565 missense probably benign 0.00
R5133:Med13 UTSW 11 86319849 missense probably benign 0.32
R5206:Med13 UTSW 11 86319879 missense probably damaging 1.00
R5352:Med13 UTSW 11 86301468 missense possibly damaging 0.82
R5534:Med13 UTSW 11 86319365 missense probably benign 0.09
R5556:Med13 UTSW 11 86327838 missense probably benign 0.25
R5633:Med13 UTSW 11 86278931 splice site probably benign
R5769:Med13 UTSW 11 86346003 missense probably benign 0.11
R6236:Med13 UTSW 11 86328531 missense probably damaging 0.99
R6479:Med13 UTSW 11 86357527 start gained probably benign
R6487:Med13 UTSW 11 86331150 missense probably damaging 1.00
R6524:Med13 UTSW 11 86301467 missense probably damaging 0.98
R6528:Med13 UTSW 11 86298954 missense probably damaging 1.00
R6805:Med13 UTSW 11 86278796 missense possibly damaging 0.48
R6913:Med13 UTSW 11 86319876 missense probably benign
R7221:Med13 UTSW 11 86288095 missense probably benign 0.00
R7254:Med13 UTSW 11 86319835 missense probably benign
R7267:Med13 UTSW 11 86308826 missense probably benign 0.01
R7309:Med13 UTSW 11 86291062 missense probably benign 0.00
R7404:Med13 UTSW 11 86286446 missense possibly damaging 0.53
R7586:Med13 UTSW 11 86271002 missense probably damaging 0.99
R7704:Med13 UTSW 11 86345918 nonsense probably null
R8062:Med13 UTSW 11 86319438 missense probably benign
Z1176:Med13 UTSW 11 86328544 missense possibly damaging 0.91
Z1176:Med13 UTSW 11 86345862 missense probably benign 0.45
Z1176:Med13 UTSW 11 86355423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTGCTTACAAGTAACACAGGAGAAG -3'
(R):5'- TCCCACAGATGGTGATTCACATGC -3'

Sequencing Primer
(F):5'- aacacaccacctacagcc -3'
(R):5'- GTGATTCACATGCAATTACCTACC -3'
Posted On2013-05-23