Incidental Mutation 'R0482:Pde4d'
ID42071
Institutional Source Beutler Lab
Gene Symbol Pde4d
Ensembl Gene ENSMUSG00000021699
Gene Namephosphodiesterase 4D, cAMP specific
Synonymsdunce, Dpde3, 9630011N22Rik
MMRRC Submission 038682-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0482 (G1)
Quality Score212
Status Validated
Chromosome13
Chromosomal Location108449948-109953461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 109936710 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 347 (V347I)
Ref Sequence ENSEMBL: ENSMUSP00000136485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074103] [ENSMUST00000079975] [ENSMUST00000117420] [ENSMUST00000117879] [ENSMUST00000119507] [ENSMUST00000119672] [ENSMUST00000120664] [ENSMUST00000120671] [ENSMUST00000122041] [ENSMUST00000135275] [ENSMUST00000177907]
Predicted Effect probably benign
Transcript: ENSMUST00000074103
AA Change: V278I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000073742
Gene: ENSMUSG00000021699
AA Change: V278I

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
HDc 329 504 1.12e-2 SMART
low complexity region 652 667 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079975
AA Change: V298I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078891
Gene: ENSMUSG00000021699
AA Change: V298I

DomainStartEndE-ValueType
HDc 349 524 1.12e-2 SMART
low complexity region 672 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117420
AA Change: V117I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113610
Gene: ENSMUSG00000021699
AA Change: V117I

DomainStartEndE-ValueType
HDc 168 343 1.12e-2 SMART
low complexity region 491 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117879
AA Change: V104I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112774
Gene: ENSMUSG00000021699
AA Change: V104I

DomainStartEndE-ValueType
HDc 155 330 1.12e-2 SMART
low complexity region 478 493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119507
AA Change: V303I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114089
Gene: ENSMUSG00000021699
AA Change: V303I

DomainStartEndE-ValueType
HDc 354 529 1.12e-2 SMART
low complexity region 677 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119672
Predicted Effect probably benign
Transcript: ENSMUST00000120664
AA Change: V184I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113024
Gene: ENSMUSG00000021699
AA Change: V184I

DomainStartEndE-ValueType
HDc 235 410 1.12e-2 SMART
low complexity region 558 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120671
AA Change: V403I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112991
Gene: ENSMUSG00000021699
AA Change: V403I

DomainStartEndE-ValueType
low complexity region 45 84 N/A INTRINSIC
HDc 454 629 1.12e-2 SMART
low complexity region 777 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122041
AA Change: V347I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113488
Gene: ENSMUSG00000021699
AA Change: V347I

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135275
AA Change: V300I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119583
Gene: ENSMUSG00000021699
AA Change: V300I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
HDc 351 526 1.12e-2 SMART
low complexity region 674 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151429
Predicted Effect unknown
Transcript: ENSMUST00000153234
AA Change: V353I
SMART Domains Protein: ENSMUSP00000121592
Gene: ENSMUSG00000021699
AA Change: V353I

DomainStartEndE-ValueType
PDB:1E9K|A 22 59 9e-18 PDB
low complexity region 69 85 N/A INTRINSIC
HDc 405 580 1.12e-2 SMART
low complexity region 728 743 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000155459
AA Change: V67I
SMART Domains Protein: ENSMUSP00000114945
Gene: ENSMUSG00000021699
AA Change: V67I

DomainStartEndE-ValueType
Pfam:PDEase_I 121 189 2.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177907
AA Change: V347I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000136485
Gene: ENSMUSG00000021699
AA Change: V347I

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Meta Mutation Damage Score 0.0726 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 95% (94/99)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed growth, female infertility associated with impaired ovulation, and reduced postnatal viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,988,423 probably null Het
Abca13 G A 11: 9,328,207 G3129D possibly damaging Het
Acnat2 T C 4: 49,383,534 I6M probably benign Het
Adcy4 T A 14: 55,774,572 probably null Het
Agrn A G 4: 156,173,555 S1117P probably damaging Het
Anks1b A G 10: 90,359,195 N545S probably benign Het
Antxr1 C T 6: 87,269,238 probably null Het
Arhgef17 T C 7: 100,880,621 K476E probably damaging Het
Bptf T C 11: 107,081,262 S927G probably benign Het
Cacna1s C T 1: 136,113,394 T1286I probably benign Het
Ccdc174 T A 6: 91,895,266 M292K probably benign Het
Cdk5rap2 G A 4: 70,410,269 probably benign Het
Celsr3 T A 9: 108,829,073 Y918* probably null Het
Cep250 T C 2: 155,964,974 probably benign Het
Ces2h A G 8: 105,020,271 D513G possibly damaging Het
Clec2l A G 6: 38,663,392 T53A probably benign Het
Cntnap2 C T 6: 45,715,816 S77L probably benign Het
Cped1 A T 6: 22,016,958 H102L probably benign Het
Crim1 T A 17: 78,372,579 D916E probably benign Het
Csmd1 T A 8: 16,233,101 I614F probably damaging Het
Csnk1g1 G A 9: 66,010,469 E37K probably damaging Het
Ctnnbl1 T A 2: 157,871,190 probably null Het
Cuzd1 A T 7: 131,309,872 probably benign Het
Cyp4f16 T A 17: 32,550,551 V433D probably damaging Het
Ddi1 A G 9: 6,266,144 L75P probably damaging Het
Ddias G A 7: 92,859,528 A393V probably benign Het
Dgka A T 10: 128,734,121 Y123* probably null Het
Dlgap1 T C 17: 70,516,190 C57R probably benign Het
Dysf T A 6: 84,152,405 V1458D probably benign Het
Eif2ak4 T A 2: 118,462,347 Y1230N probably damaging Het
Fam160a2 G A 7: 105,384,212 P599L possibly damaging Het
Fam46a T C 9: 85,325,055 Y230C probably damaging Het
Fbxl7 A T 15: 26,543,546 S338R probably benign Het
Fgf23 A T 6: 127,073,159 T44S probably damaging Het
Folh1 A T 7: 86,746,101 probably benign Het
Gpsm2 A T 3: 108,702,394 probably benign Het
Hdac2 T A 10: 36,989,134 probably benign Het
Hist1h2bl A G 13: 21,716,125 probably benign Het
Il31ra G T 13: 112,527,481 T446N possibly damaging Het
Irf5 T A 6: 29,535,370 L199H probably benign Het
Kif18a T A 2: 109,287,843 M1K probably null Het
Kif4-ps A C 12: 101,148,662 I1017L probably benign Het
Klhl2 C T 8: 64,758,130 V295M probably benign Het
Krt75 A T 15: 101,570,311 M296K probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lgr4 T C 2: 110,008,092 S439P probably damaging Het
Lhfpl2 C A 13: 94,174,610 N129K probably damaging Het
Lnx2 A G 5: 147,018,961 V675A probably damaging Het
Med13 T C 11: 86,285,151 T1673A probably benign Het
Mif A G 10: 75,860,140 V10A possibly damaging Het
Mki67 A T 7: 135,699,429 I1292N possibly damaging Het
Mylip C A 13: 45,404,583 N89K probably benign Het
Myo19 G T 11: 84,909,419 D877Y probably benign Het
Nckap5 A G 1: 126,026,365 S753P possibly damaging Het
Nlrc3 T C 16: 3,965,192 T118A possibly damaging Het
Nptx2 T C 5: 144,553,459 Y233H probably damaging Het
Nsl1 T A 1: 191,063,040 M1K probably null Het
Ntsr1 T A 2: 180,501,056 S213R possibly damaging Het
Olfr1225 A T 2: 89,170,631 F194I probably benign Het
Olfr48 A G 2: 89,844,169 V268A probably benign Het
Olfr669 T A 7: 104,938,814 F96Y possibly damaging Het
Pik3r4 T A 9: 105,669,045 S865T probably benign Het
Ppp2r2d A G 7: 138,870,431 R136G probably benign Het
Proser2 A C 2: 6,113,910 S41A probably damaging Het
Proz A T 8: 13,073,460 K244* probably null Het
Prpf38b A T 3: 108,905,270 L209H probably damaging Het
R3hdm1 C A 1: 128,184,517 A390E probably benign Het
Rb1cc1 A C 1: 6,240,323 D315A probably damaging Het
Rnf141 G A 7: 110,837,138 R28* probably null Het
Rps6kc1 A T 1: 190,799,430 S792T probably benign Het
Rxrg A G 1: 167,631,037 D233G possibly damaging Het
Sh2d7 A G 9: 54,541,037 N114S probably benign Het
Slc25a38 T C 9: 120,120,833 V205A probably benign Het
Slc4a10 T C 2: 62,297,017 probably benign Het
Spred1 T A 2: 117,152,978 probably null Het
Stt3b A G 9: 115,248,567 S706P probably benign Het
Tcerg1 C A 18: 42,564,240 probably benign Het
Thsd4 A T 9: 60,002,978 I109N probably damaging Het
Ticrr C A 7: 79,694,488 P1367Q probably damaging Het
Trpv1 A G 11: 73,239,429 D146G probably damaging Het
Tubd1 T G 11: 86,557,776 V305G possibly damaging Het
Tubgcp4 T C 2: 121,175,374 L81P probably benign Het
Ubxn2b T A 4: 6,196,404 probably null Het
Usp36 A T 11: 118,265,194 S586T probably benign Het
Vcan T A 13: 89,678,145 D2220V probably damaging Het
Vmn1r173 T A 7: 23,702,791 N150K probably damaging Het
Vmn1r70 G A 7: 10,634,277 A231T probably damaging Het
Vmn2r97 A G 17: 18,947,668 D728G probably damaging Het
Zbtb40 T C 4: 136,983,228 E1200G probably damaging Het
Zfp365 A T 10: 67,897,606 V252D probably damaging Het
Other mutations in Pde4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pde4d APN 13 109936687 missense possibly damaging 0.69
IGL00792:Pde4d APN 13 109935395 missense possibly damaging 0.85
IGL01014:Pde4d APN 13 109949502 missense probably damaging 1.00
IGL01660:Pde4d APN 13 109938072 missense probably damaging 1.00
IGL02233:Pde4d APN 13 109740550 missense probably damaging 1.00
IGL02405:Pde4d APN 13 108860209 critical splice donor site probably null
IGL02544:Pde4d APN 13 109740523 missense probably damaging 1.00
IGL02885:Pde4d APN 13 109948261 missense probably damaging 1.00
IGL03286:Pde4d APN 13 109954506 unclassified probably benign
IGL03406:Pde4d APN 13 109954591 unclassified probably benign
Heliosphere UTSW 13 109116942 missense probably benign
Stubbs UTSW 13 109772722 intron probably benign
IGL03055:Pde4d UTSW 13 109935345 missense probably damaging 1.00
R0020:Pde4d UTSW 13 109954570 missense possibly damaging 0.66
R0020:Pde4d UTSW 13 109954570 missense possibly damaging 0.66
R0054:Pde4d UTSW 13 109740421 missense probably benign 0.23
R0054:Pde4d UTSW 13 109740421 missense probably benign 0.23
R0357:Pde4d UTSW 13 109951268 missense possibly damaging 0.46
R0689:Pde4d UTSW 13 109740544 missense possibly damaging 0.78
R0884:Pde4d UTSW 13 109950940 missense probably damaging 0.99
R1169:Pde4d UTSW 13 109950928 splice site probably null
R1225:Pde4d UTSW 13 109950221 missense probably benign 0.04
R1246:Pde4d UTSW 13 109950973 missense probably damaging 1.00
R1344:Pde4d UTSW 13 109950387 nonsense probably null
R1351:Pde4d UTSW 13 109951275 missense possibly damaging 0.46
R1371:Pde4d UTSW 13 109117061 missense probably benign 0.00
R1418:Pde4d UTSW 13 109950387 nonsense probably null
R2197:Pde4d UTSW 13 109948390 missense probably damaging 1.00
R2440:Pde4d UTSW 13 109927197 intron probably benign
R3114:Pde4d UTSW 13 109948258 missense probably damaging 1.00
R3115:Pde4d UTSW 13 109948258 missense probably damaging 1.00
R3722:Pde4d UTSW 13 109951332 nonsense probably null
R3742:Pde4d UTSW 13 109740479 missense probably benign 0.42
R3797:Pde4d UTSW 13 109632897 missense probably benign 0.29
R3983:Pde4d UTSW 13 109740406 missense probably benign 0.23
R4618:Pde4d UTSW 13 109933877 missense probably benign 0.13
R4768:Pde4d UTSW 13 109933874 missense probably damaging 1.00
R4795:Pde4d UTSW 13 109938171 intron probably benign
R4824:Pde4d UTSW 13 109116866 missense probably benign 0.00
R4942:Pde4d UTSW 13 108860199 missense probably benign 0.00
R4984:Pde4d UTSW 13 109740464 missense probably damaging 1.00
R5180:Pde4d UTSW 13 109740473 missense probably benign 0.13
R5267:Pde4d UTSW 13 109260809 intron probably benign
R5311:Pde4d UTSW 13 109632864 missense probably benign 0.02
R5311:Pde4d UTSW 13 109632865 missense probably benign
R5376:Pde4d UTSW 13 109772644 missense probably benign 0.00
R5551:Pde4d UTSW 13 109948396 critical splice donor site probably null
R5753:Pde4d UTSW 13 109772722 intron probably benign
R5754:Pde4d UTSW 13 109938013 missense probably damaging 0.98
R5838:Pde4d UTSW 13 109740442 missense probably damaging 0.99
R5864:Pde4d UTSW 13 109938048 missense probably benign 0.00
R6039:Pde4d UTSW 13 109948342 missense probably damaging 1.00
R6039:Pde4d UTSW 13 109948342 missense probably damaging 1.00
R6049:Pde4d UTSW 13 109032585 nonsense probably null
R6214:Pde4d UTSW 13 109949433 missense probably damaging 1.00
R6215:Pde4d UTSW 13 109949433 missense probably damaging 1.00
R6273:Pde4d UTSW 13 109950221 missense possibly damaging 0.94
R6431:Pde4d UTSW 13 109601786 unclassified probably null
R6501:Pde4d UTSW 13 109116942 missense probably benign
R6534:Pde4d UTSW 13 109632901 missense probably benign 0.05
R6709:Pde4d UTSW 13 109948279 missense probably damaging 1.00
R6722:Pde4d UTSW 13 109632898 nonsense probably null
R7164:Pde4d UTSW 13 109032688 missense probably benign
R7222:Pde4d UTSW 13 109757579 missense probably damaging 1.00
R7417:Pde4d UTSW 13 109632788 synonymous probably null
R7489:Pde4d UTSW 13 109116767 missense unknown
R7563:Pde4d UTSW 13 109951007 missense probably benign 0.37
R7861:Pde4d UTSW 13 109935324 missense probably damaging 0.99
R7944:Pde4d UTSW 13 109935324 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCTTGTGTTTGACTGTTCACATGC -3'
(R):5'- CTTGAAGATTCTGTCCTGCCCCAG -3'

Sequencing Primer
(F):5'- GACTGTTCACATGCCATTTCC -3'
(R):5'- CTGTGAGCTGAAATGAATCCC -3'
Posted On2013-05-23