Incidental Mutation 'R0482:Dlgap1'
ID 42081
Institutional Source Beutler Lab
Gene Symbol Dlgap1
Ensembl Gene ENSMUSG00000003279
Gene Name DLG associated protein 1
Synonyms Sapap1, Gkap, GKAP/SAPAP, SAPAP1, D17Bwg0511e, DAP-1 beta, 4933422O14Rik
MMRRC Submission 038682-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0482 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 70276068-71128408 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70823185 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 57 (C57R)
Ref Sequence ENSEMBL: ENSMUSP00000122896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060072] [ENSMUST00000133983] [ENSMUST00000135938] [ENSMUST00000146730] [ENSMUST00000155016]
AlphaFold Q9D415
Predicted Effect probably benign
Transcript: ENSMUST00000060072
AA Change: C57R

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000052858
Gene: ENSMUSG00000003279
AA Change: C57R

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 515 539 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
low complexity region 628 642 N/A INTRINSIC
Pfam:GKAP 643 982 6.8e-139 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130971
Predicted Effect probably benign
Transcript: ENSMUST00000133983
AA Change: C57R

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116716
Gene: ENSMUSG00000003279
AA Change: C57R

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 515 539 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
low complexity region 628 642 N/A INTRINSIC
Pfam:GKAP 643 982 6.8e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135938
AA Change: C57R

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118497
Gene: ENSMUSG00000003279
AA Change: C57R

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 610 624 N/A INTRINSIC
Pfam:GKAP 625 964 9.3e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146730
AA Change: C57R

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000116072
Gene: ENSMUSG00000003279
AA Change: C57R

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 552 569 N/A INTRINSIC
low complexity region 638 652 N/A INTRINSIC
Pfam:GKAP 653 933 9.5e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155016
AA Change: C57R

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122896
Gene: ENSMUSG00000003279
AA Change: C57R

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 552 569 N/A INTRINSIC
low complexity region 638 652 N/A INTRINSIC
Pfam:GKAP 660 992 2e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150798
Meta Mutation Damage Score 0.8504 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 95% (94/99)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,207,255 (GRCm39) probably null Het
Abca13 G A 11: 9,278,207 (GRCm39) G3129D possibly damaging Het
Acnat2 T C 4: 49,383,534 (GRCm39) I6M probably benign Het
Adcy4 T A 14: 56,012,029 (GRCm39) probably null Het
Agrn A G 4: 156,258,012 (GRCm39) S1117P probably damaging Het
Anks1b A G 10: 90,195,057 (GRCm39) N545S probably benign Het
Antxr1 C T 6: 87,246,220 (GRCm39) probably null Het
Arhgef17 T C 7: 100,529,828 (GRCm39) K476E probably damaging Het
Bptf T C 11: 106,972,088 (GRCm39) S927G probably benign Het
Cacna1s C T 1: 136,041,132 (GRCm39) T1286I probably benign Het
Ccdc174 T A 6: 91,872,247 (GRCm39) M292K probably benign Het
Cdk5rap2 G A 4: 70,328,506 (GRCm39) probably benign Het
Celsr3 T A 9: 108,706,272 (GRCm39) Y918* probably null Het
Cep250 T C 2: 155,806,894 (GRCm39) probably benign Het
Ces2h A G 8: 105,746,903 (GRCm39) D513G possibly damaging Het
Clec2l A G 6: 38,640,327 (GRCm39) T53A probably benign Het
Cntnap2 C T 6: 45,692,750 (GRCm39) S77L probably benign Het
Cped1 A T 6: 22,016,957 (GRCm39) H102L probably benign Het
Crim1 T A 17: 78,680,008 (GRCm39) D916E probably benign Het
Csmd1 T A 8: 16,283,115 (GRCm39) I614F probably damaging Het
Csnk1g1 G A 9: 65,917,751 (GRCm39) E37K probably damaging Het
Ctnnbl1 T A 2: 157,713,110 (GRCm39) probably null Het
Cuzd1 A T 7: 130,911,601 (GRCm39) probably benign Het
Cyp4f16 T A 17: 32,769,525 (GRCm39) V433D probably damaging Het
Ddi1 A G 9: 6,266,144 (GRCm39) L75P probably damaging Het
Ddias G A 7: 92,508,736 (GRCm39) A393V probably benign Het
Dgka A T 10: 128,569,990 (GRCm39) Y123* probably null Het
Dysf T A 6: 84,129,387 (GRCm39) V1458D probably benign Het
Eif2ak4 T A 2: 118,292,828 (GRCm39) Y1230N probably damaging Het
Fbxl7 A T 15: 26,543,632 (GRCm39) S338R probably benign Het
Fgf23 A T 6: 127,050,122 (GRCm39) T44S probably damaging Het
Fhip1b G A 7: 105,033,419 (GRCm39) P599L possibly damaging Het
Folh1 A T 7: 86,395,309 (GRCm39) probably benign Het
Gpsm2 A T 3: 108,609,710 (GRCm39) probably benign Het
H2bc13 A G 13: 21,900,295 (GRCm39) probably benign Het
Hdac2 T A 10: 36,865,130 (GRCm39) probably benign Het
Il31ra G T 13: 112,664,015 (GRCm39) T446N possibly damaging Het
Irf5 T A 6: 29,535,369 (GRCm39) L199H probably benign Het
Kif18a T A 2: 109,118,188 (GRCm39) M1K probably null Het
Kif4-ps A C 12: 101,114,921 (GRCm39) I1017L probably benign Het
Klhl2 C T 8: 65,211,164 (GRCm39) V295M probably benign Het
Krt75 A T 15: 101,478,746 (GRCm39) M296K probably benign Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Lgr4 T C 2: 109,838,437 (GRCm39) S439P probably damaging Het
Lhfpl2 C A 13: 94,311,118 (GRCm39) N129K probably damaging Het
Lnx2 A G 5: 146,955,771 (GRCm39) V675A probably damaging Het
Med13 T C 11: 86,175,977 (GRCm39) T1673A probably benign Het
Mif A G 10: 75,695,974 (GRCm39) V10A possibly damaging Het
Mki67 A T 7: 135,301,158 (GRCm39) I1292N possibly damaging Het
Mylip C A 13: 45,558,059 (GRCm39) N89K probably benign Het
Myo19 G T 11: 84,800,245 (GRCm39) D877Y probably benign Het
Nckap5 A G 1: 125,954,102 (GRCm39) S753P possibly damaging Het
Nlrc3 T C 16: 3,783,056 (GRCm39) T118A possibly damaging Het
Nptx2 T C 5: 144,490,269 (GRCm39) Y233H probably damaging Het
Nsl1 T A 1: 190,795,237 (GRCm39) M1K probably null Het
Ntsr1 T A 2: 180,142,849 (GRCm39) S213R possibly damaging Het
Or4c120 A T 2: 89,000,975 (GRCm39) F194I probably benign Het
Or4c58 A G 2: 89,674,513 (GRCm39) V268A probably benign Het
Or52n5 T A 7: 104,588,021 (GRCm39) F96Y possibly damaging Het
Pde4d G A 13: 110,073,244 (GRCm39) V347I probably benign Het
Pik3r4 T A 9: 105,546,244 (GRCm39) S865T probably benign Het
Ppp2r2d A G 7: 138,472,160 (GRCm39) R136G probably benign Het
Proser2 A C 2: 6,118,721 (GRCm39) S41A probably damaging Het
Proz A T 8: 13,123,460 (GRCm39) K244* probably null Het
Prpf38b A T 3: 108,812,586 (GRCm39) L209H probably damaging Het
R3hdm1 C A 1: 128,112,254 (GRCm39) A390E probably benign Het
Rb1cc1 A C 1: 6,310,547 (GRCm39) D315A probably damaging Het
Rnf141 G A 7: 110,436,345 (GRCm39) R28* probably null Het
Rps6kc1 A T 1: 190,531,627 (GRCm39) S792T probably benign Het
Rxrg A G 1: 167,458,606 (GRCm39) D233G possibly damaging Het
Sh2d7 A G 9: 54,448,321 (GRCm39) N114S probably benign Het
Slc25a38 T C 9: 119,949,899 (GRCm39) V205A probably benign Het
Slc4a10 T C 2: 62,127,361 (GRCm39) probably benign Het
Spred1 T A 2: 116,983,459 (GRCm39) probably null Het
Stt3b A G 9: 115,077,635 (GRCm39) S706P probably benign Het
Tcerg1 C A 18: 42,697,305 (GRCm39) probably benign Het
Tent5a T C 9: 85,207,108 (GRCm39) Y230C probably damaging Het
Thsd4 A T 9: 59,910,261 (GRCm39) I109N probably damaging Het
Ticrr C A 7: 79,344,236 (GRCm39) P1367Q probably damaging Het
Trpv1 A G 11: 73,130,255 (GRCm39) D146G probably damaging Het
Tubd1 T G 11: 86,448,602 (GRCm39) V305G possibly damaging Het
Tubgcp4 T C 2: 121,005,855 (GRCm39) L81P probably benign Het
Ubxn2b T A 4: 6,196,404 (GRCm39) probably null Het
Usp36 A T 11: 118,156,020 (GRCm39) S586T probably benign Het
Vcan T A 13: 89,826,264 (GRCm39) D2220V probably damaging Het
Vmn1r173 T A 7: 23,402,216 (GRCm39) N150K probably damaging Het
Vmn1r70 G A 7: 10,368,204 (GRCm39) A231T probably damaging Het
Vmn2r97 A G 17: 19,167,930 (GRCm39) D728G probably damaging Het
Zbtb40 T C 4: 136,710,539 (GRCm39) E1200G probably damaging Het
Zfp365 A T 10: 67,733,436 (GRCm39) V252D probably damaging Het
Other mutations in Dlgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Dlgap1 APN 17 70,823,080 (GRCm39) missense probably benign 0.02
IGL01413:Dlgap1 APN 17 70,823,069 (GRCm39) missense probably benign 0.00
IGL01531:Dlgap1 APN 17 70,823,374 (GRCm39) missense probably damaging 1.00
IGL02226:Dlgap1 APN 17 70,823,029 (GRCm39) missense probably damaging 1.00
BB009:Dlgap1 UTSW 17 70,823,233 (GRCm39) missense probably damaging 1.00
BB019:Dlgap1 UTSW 17 70,823,233 (GRCm39) missense probably damaging 1.00
R0453:Dlgap1 UTSW 17 71,068,341 (GRCm39) missense probably benign 0.03
R0520:Dlgap1 UTSW 17 70,823,989 (GRCm39) nonsense probably null
R1951:Dlgap1 UTSW 17 71,068,306 (GRCm39) missense probably damaging 0.96
R2072:Dlgap1 UTSW 17 70,969,765 (GRCm39) missense probably damaging 0.99
R2076:Dlgap1 UTSW 17 71,093,826 (GRCm39) nonsense probably null
R3438:Dlgap1 UTSW 17 70,823,356 (GRCm39) missense probably damaging 0.97
R3743:Dlgap1 UTSW 17 71,025,221 (GRCm39) critical splice donor site probably null
R3881:Dlgap1 UTSW 17 71,093,810 (GRCm39) missense probably damaging 1.00
R3981:Dlgap1 UTSW 17 70,823,780 (GRCm39) missense probably damaging 1.00
R4043:Dlgap1 UTSW 17 71,068,075 (GRCm39) missense probably damaging 1.00
R4272:Dlgap1 UTSW 17 71,073,038 (GRCm39) missense probably benign
R4273:Dlgap1 UTSW 17 71,073,038 (GRCm39) missense probably benign
R4557:Dlgap1 UTSW 17 70,823,684 (GRCm39) missense probably benign 0.01
R4652:Dlgap1 UTSW 17 71,068,090 (GRCm39) missense probably damaging 1.00
R4771:Dlgap1 UTSW 17 70,900,375 (GRCm39) nonsense probably null
R5000:Dlgap1 UTSW 17 71,073,053 (GRCm39) missense probably damaging 1.00
R5004:Dlgap1 UTSW 17 71,025,222 (GRCm39) critical splice donor site probably null
R5291:Dlgap1 UTSW 17 71,025,205 (GRCm39) missense probably benign 0.03
R5304:Dlgap1 UTSW 17 71,122,202 (GRCm39) missense probably damaging 1.00
R5473:Dlgap1 UTSW 17 70,824,025 (GRCm39) intron probably benign
R5522:Dlgap1 UTSW 17 70,823,993 (GRCm39) critical splice donor site probably null
R5586:Dlgap1 UTSW 17 71,125,156 (GRCm39) missense probably damaging 1.00
R5742:Dlgap1 UTSW 17 71,025,194 (GRCm39) missense probably benign
R5802:Dlgap1 UTSW 17 71,073,086 (GRCm39) critical splice donor site probably null
R5850:Dlgap1 UTSW 17 71,094,087 (GRCm39) missense probably damaging 1.00
R5857:Dlgap1 UTSW 17 71,122,388 (GRCm39) intron probably benign
R5883:Dlgap1 UTSW 17 70,824,008 (GRCm39) intron probably benign
R6045:Dlgap1 UTSW 17 71,125,093 (GRCm39) missense probably damaging 1.00
R6336:Dlgap1 UTSW 17 71,122,284 (GRCm39) missense probably damaging 1.00
R6448:Dlgap1 UTSW 17 70,900,325 (GRCm39) missense possibly damaging 0.59
R6682:Dlgap1 UTSW 17 71,094,118 (GRCm39) missense probably damaging 1.00
R6795:Dlgap1 UTSW 17 71,125,069 (GRCm39) missense possibly damaging 0.48
R7147:Dlgap1 UTSW 17 70,969,753 (GRCm39) missense probably benign 0.00
R7187:Dlgap1 UTSW 17 70,823,093 (GRCm39) missense possibly damaging 0.93
R7382:Dlgap1 UTSW 17 71,094,169 (GRCm39) missense probably damaging 1.00
R7859:Dlgap1 UTSW 17 70,823,683 (GRCm39) missense probably benign
R7932:Dlgap1 UTSW 17 70,823,233 (GRCm39) missense probably damaging 1.00
R8477:Dlgap1 UTSW 17 70,823,967 (GRCm39) missense probably damaging 1.00
R8673:Dlgap1 UTSW 17 71,122,293 (GRCm39) missense probably damaging 1.00
R8866:Dlgap1 UTSW 17 70,823,435 (GRCm39) missense probably damaging 1.00
R8910:Dlgap1 UTSW 17 71,093,815 (GRCm39) missense probably damaging 1.00
R8997:Dlgap1 UTSW 17 70,823,528 (GRCm39) missense possibly damaging 0.63
R9012:Dlgap1 UTSW 17 70,823,182 (GRCm39) missense possibly damaging 0.94
R9035:Dlgap1 UTSW 17 70,823,855 (GRCm39) missense possibly damaging 0.73
R9067:Dlgap1 UTSW 17 71,116,186 (GRCm39) missense probably damaging 1.00
R9361:Dlgap1 UTSW 17 71,068,259 (GRCm39) missense probably damaging 1.00
R9464:Dlgap1 UTSW 17 70,823,964 (GRCm39) missense probably benign 0.11
R9550:Dlgap1 UTSW 17 71,093,902 (GRCm39) missense possibly damaging 0.61
R9564:Dlgap1 UTSW 17 70,964,458 (GRCm39) missense probably benign 0.02
R9565:Dlgap1 UTSW 17 70,964,458 (GRCm39) missense probably benign 0.02
T0975:Dlgap1 UTSW 17 70,823,950 (GRCm39) missense possibly damaging 0.86
Z1176:Dlgap1 UTSW 17 71,122,204 (GRCm39) missense probably damaging 1.00
Z1177:Dlgap1 UTSW 17 70,969,738 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCAAGAAGGGTCTGGAACTTAAC -3'
(R):5'- GCTTGTACTGTAGCGTGTGATAGCC -3'

Sequencing Primer
(F):5'- GATTGCTTCCAGTCAGCAATG -3'
(R):5'- TAGCGTGTGATAGCCATCCC -3'
Posted On 2013-05-23