Incidental Mutation 'R0482:Tcerg1'
ID 42083
Institutional Source Beutler Lab
Gene Symbol Tcerg1
Ensembl Gene ENSMUSG00000024498
Gene Name transcription elongation regulator 1 (CA150)
Synonyms ca150, p144, Fbp28, 2900090C16Rik, Taf2s, 2410022J09Rik
MMRRC Submission 038682-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0482 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 42644552-42708858 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 42697305 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025375] [ENSMUST00000173642]
AlphaFold Q8CGF7
Predicted Effect probably benign
Transcript: ENSMUST00000025375
SMART Domains Protein: ENSMUSP00000025375
Gene: ENSMUSG00000024498

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
FF 1014 1079 1.3e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173642
SMART Domains Protein: ENSMUSP00000134458
Gene: ENSMUSG00000024498

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that regulates transcriptional elongation and pre-mRNA splicing. The encoded protein interacts with the hyperphosphorylated C-terminal domain of RNA polymerase II via multiple FF domains, and with the pre-mRNA splicing factor SF1 via a WW domain. Alternative splicing results in multiple transcripts variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,207,255 (GRCm39) probably null Het
Abca13 G A 11: 9,278,207 (GRCm39) G3129D possibly damaging Het
Acnat2 T C 4: 49,383,534 (GRCm39) I6M probably benign Het
Adcy4 T A 14: 56,012,029 (GRCm39) probably null Het
Agrn A G 4: 156,258,012 (GRCm39) S1117P probably damaging Het
Anks1b A G 10: 90,195,057 (GRCm39) N545S probably benign Het
Antxr1 C T 6: 87,246,220 (GRCm39) probably null Het
Arhgef17 T C 7: 100,529,828 (GRCm39) K476E probably damaging Het
Bptf T C 11: 106,972,088 (GRCm39) S927G probably benign Het
Cacna1s C T 1: 136,041,132 (GRCm39) T1286I probably benign Het
Ccdc174 T A 6: 91,872,247 (GRCm39) M292K probably benign Het
Cdk5rap2 G A 4: 70,328,506 (GRCm39) probably benign Het
Celsr3 T A 9: 108,706,272 (GRCm39) Y918* probably null Het
Cep250 T C 2: 155,806,894 (GRCm39) probably benign Het
Ces2h A G 8: 105,746,903 (GRCm39) D513G possibly damaging Het
Clec2l A G 6: 38,640,327 (GRCm39) T53A probably benign Het
Cntnap2 C T 6: 45,692,750 (GRCm39) S77L probably benign Het
Cped1 A T 6: 22,016,957 (GRCm39) H102L probably benign Het
Crim1 T A 17: 78,680,008 (GRCm39) D916E probably benign Het
Csmd1 T A 8: 16,283,115 (GRCm39) I614F probably damaging Het
Csnk1g1 G A 9: 65,917,751 (GRCm39) E37K probably damaging Het
Ctnnbl1 T A 2: 157,713,110 (GRCm39) probably null Het
Cuzd1 A T 7: 130,911,601 (GRCm39) probably benign Het
Cyp4f16 T A 17: 32,769,525 (GRCm39) V433D probably damaging Het
Ddi1 A G 9: 6,266,144 (GRCm39) L75P probably damaging Het
Ddias G A 7: 92,508,736 (GRCm39) A393V probably benign Het
Dgka A T 10: 128,569,990 (GRCm39) Y123* probably null Het
Dlgap1 T C 17: 70,823,185 (GRCm39) C57R probably benign Het
Dysf T A 6: 84,129,387 (GRCm39) V1458D probably benign Het
Eif2ak4 T A 2: 118,292,828 (GRCm39) Y1230N probably damaging Het
Fbxl7 A T 15: 26,543,632 (GRCm39) S338R probably benign Het
Fgf23 A T 6: 127,050,122 (GRCm39) T44S probably damaging Het
Fhip1b G A 7: 105,033,419 (GRCm39) P599L possibly damaging Het
Folh1 A T 7: 86,395,309 (GRCm39) probably benign Het
Gpsm2 A T 3: 108,609,710 (GRCm39) probably benign Het
H2bc13 A G 13: 21,900,295 (GRCm39) probably benign Het
Hdac2 T A 10: 36,865,130 (GRCm39) probably benign Het
Il31ra G T 13: 112,664,015 (GRCm39) T446N possibly damaging Het
Irf5 T A 6: 29,535,369 (GRCm39) L199H probably benign Het
Kif18a T A 2: 109,118,188 (GRCm39) M1K probably null Het
Kif4-ps A C 12: 101,114,921 (GRCm39) I1017L probably benign Het
Klhl2 C T 8: 65,211,164 (GRCm39) V295M probably benign Het
Krt75 A T 15: 101,478,746 (GRCm39) M296K probably benign Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Lgr4 T C 2: 109,838,437 (GRCm39) S439P probably damaging Het
Lhfpl2 C A 13: 94,311,118 (GRCm39) N129K probably damaging Het
Lnx2 A G 5: 146,955,771 (GRCm39) V675A probably damaging Het
Med13 T C 11: 86,175,977 (GRCm39) T1673A probably benign Het
Mif A G 10: 75,695,974 (GRCm39) V10A possibly damaging Het
Mki67 A T 7: 135,301,158 (GRCm39) I1292N possibly damaging Het
Mylip C A 13: 45,558,059 (GRCm39) N89K probably benign Het
Myo19 G T 11: 84,800,245 (GRCm39) D877Y probably benign Het
Nckap5 A G 1: 125,954,102 (GRCm39) S753P possibly damaging Het
Nlrc3 T C 16: 3,783,056 (GRCm39) T118A possibly damaging Het
Nptx2 T C 5: 144,490,269 (GRCm39) Y233H probably damaging Het
Nsl1 T A 1: 190,795,237 (GRCm39) M1K probably null Het
Ntsr1 T A 2: 180,142,849 (GRCm39) S213R possibly damaging Het
Or4c120 A T 2: 89,000,975 (GRCm39) F194I probably benign Het
Or4c58 A G 2: 89,674,513 (GRCm39) V268A probably benign Het
Or52n5 T A 7: 104,588,021 (GRCm39) F96Y possibly damaging Het
Pde4d G A 13: 110,073,244 (GRCm39) V347I probably benign Het
Pik3r4 T A 9: 105,546,244 (GRCm39) S865T probably benign Het
Ppp2r2d A G 7: 138,472,160 (GRCm39) R136G probably benign Het
Proser2 A C 2: 6,118,721 (GRCm39) S41A probably damaging Het
Proz A T 8: 13,123,460 (GRCm39) K244* probably null Het
Prpf38b A T 3: 108,812,586 (GRCm39) L209H probably damaging Het
R3hdm1 C A 1: 128,112,254 (GRCm39) A390E probably benign Het
Rb1cc1 A C 1: 6,310,547 (GRCm39) D315A probably damaging Het
Rnf141 G A 7: 110,436,345 (GRCm39) R28* probably null Het
Rps6kc1 A T 1: 190,531,627 (GRCm39) S792T probably benign Het
Rxrg A G 1: 167,458,606 (GRCm39) D233G possibly damaging Het
Sh2d7 A G 9: 54,448,321 (GRCm39) N114S probably benign Het
Slc25a38 T C 9: 119,949,899 (GRCm39) V205A probably benign Het
Slc4a10 T C 2: 62,127,361 (GRCm39) probably benign Het
Spred1 T A 2: 116,983,459 (GRCm39) probably null Het
Stt3b A G 9: 115,077,635 (GRCm39) S706P probably benign Het
Tent5a T C 9: 85,207,108 (GRCm39) Y230C probably damaging Het
Thsd4 A T 9: 59,910,261 (GRCm39) I109N probably damaging Het
Ticrr C A 7: 79,344,236 (GRCm39) P1367Q probably damaging Het
Trpv1 A G 11: 73,130,255 (GRCm39) D146G probably damaging Het
Tubd1 T G 11: 86,448,602 (GRCm39) V305G possibly damaging Het
Tubgcp4 T C 2: 121,005,855 (GRCm39) L81P probably benign Het
Ubxn2b T A 4: 6,196,404 (GRCm39) probably null Het
Usp36 A T 11: 118,156,020 (GRCm39) S586T probably benign Het
Vcan T A 13: 89,826,264 (GRCm39) D2220V probably damaging Het
Vmn1r173 T A 7: 23,402,216 (GRCm39) N150K probably damaging Het
Vmn1r70 G A 7: 10,368,204 (GRCm39) A231T probably damaging Het
Vmn2r97 A G 17: 19,167,930 (GRCm39) D728G probably damaging Het
Zbtb40 T C 4: 136,710,539 (GRCm39) E1200G probably damaging Het
Zfp365 A T 10: 67,733,436 (GRCm39) V252D probably damaging Het
Other mutations in Tcerg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00701:Tcerg1 APN 18 42,669,407 (GRCm39) missense probably benign 0.34
IGL00708:Tcerg1 APN 18 42,704,190 (GRCm39) missense probably benign 0.38
IGL00741:Tcerg1 APN 18 42,701,518 (GRCm39) missense possibly damaging 0.94
IGL01314:Tcerg1 APN 18 42,706,374 (GRCm39) missense probably damaging 1.00
IGL01358:Tcerg1 APN 18 42,657,342 (GRCm39) missense unknown
IGL01832:Tcerg1 APN 18 42,707,620 (GRCm39) missense probably damaging 0.99
IGL01985:Tcerg1 APN 18 42,663,721 (GRCm39) missense unknown
IGL02937:Tcerg1 APN 18 42,657,414 (GRCm39) missense unknown
IGL02953:Tcerg1 APN 18 42,681,535 (GRCm39) missense probably damaging 1.00
IGL03082:Tcerg1 APN 18 42,706,422 (GRCm39) missense probably damaging 1.00
P0031:Tcerg1 UTSW 18 42,706,367 (GRCm39) missense probably benign 0.07
R0060:Tcerg1 UTSW 18 42,657,073 (GRCm39) missense unknown
R0138:Tcerg1 UTSW 18 42,701,679 (GRCm39) splice site probably benign
R0502:Tcerg1 UTSW 18 42,656,021 (GRCm39) missense unknown
R0731:Tcerg1 UTSW 18 42,704,905 (GRCm39) missense probably damaging 0.99
R1117:Tcerg1 UTSW 18 42,707,717 (GRCm39) missense probably damaging 0.99
R1542:Tcerg1 UTSW 18 42,686,495 (GRCm39) missense probably damaging 0.99
R1571:Tcerg1 UTSW 18 42,657,357 (GRCm39) missense unknown
R1673:Tcerg1 UTSW 18 42,685,646 (GRCm39) missense possibly damaging 0.91
R1678:Tcerg1 UTSW 18 42,657,414 (GRCm39) missense unknown
R1799:Tcerg1 UTSW 18 42,694,012 (GRCm39) missense possibly damaging 0.92
R2094:Tcerg1 UTSW 18 42,697,210 (GRCm39) missense possibly damaging 0.92
R2231:Tcerg1 UTSW 18 42,657,309 (GRCm39) missense unknown
R2989:Tcerg1 UTSW 18 42,652,540 (GRCm39) missense unknown
R3831:Tcerg1 UTSW 18 42,701,554 (GRCm39) missense probably damaging 1.00
R4009:Tcerg1 UTSW 18 42,697,201 (GRCm39) frame shift probably null
R4034:Tcerg1 UTSW 18 42,652,598 (GRCm39) missense unknown
R4826:Tcerg1 UTSW 18 42,668,180 (GRCm39) missense unknown
R4858:Tcerg1 UTSW 18 42,657,046 (GRCm39) missense unknown
R5371:Tcerg1 UTSW 18 42,652,600 (GRCm39) missense unknown
R5865:Tcerg1 UTSW 18 42,669,413 (GRCm39) missense probably damaging 0.98
R6128:Tcerg1 UTSW 18 42,644,563 (GRCm39) splice site probably null
R6258:Tcerg1 UTSW 18 42,686,530 (GRCm39) missense probably damaging 1.00
R6260:Tcerg1 UTSW 18 42,686,530 (GRCm39) missense probably damaging 1.00
R6516:Tcerg1 UTSW 18 42,663,957 (GRCm39) critical splice donor site probably null
R6825:Tcerg1 UTSW 18 42,681,542 (GRCm39) missense probably damaging 0.98
R7147:Tcerg1 UTSW 18 42,683,128 (GRCm39) missense probably benign 0.22
R7714:Tcerg1 UTSW 18 42,694,000 (GRCm39) missense possibly damaging 0.77
R7739:Tcerg1 UTSW 18 42,657,039 (GRCm39) missense unknown
R7838:Tcerg1 UTSW 18 42,670,002 (GRCm39) missense probably benign 0.01
R8204:Tcerg1 UTSW 18 42,707,618 (GRCm39) missense probably damaging 1.00
R8293:Tcerg1 UTSW 18 42,694,020 (GRCm39) missense probably benign 0.03
R8300:Tcerg1 UTSW 18 42,683,137 (GRCm39) missense probably benign 0.22
R8426:Tcerg1 UTSW 18 42,681,466 (GRCm39) missense possibly damaging 0.68
R8514:Tcerg1 UTSW 18 42,697,187 (GRCm39) missense probably damaging 0.98
R8672:Tcerg1 UTSW 18 42,686,559 (GRCm39) missense probably damaging 1.00
R9367:Tcerg1 UTSW 18 42,685,573 (GRCm39) missense possibly damaging 0.93
R9715:Tcerg1 UTSW 18 42,706,413 (GRCm39) missense probably damaging 0.99
R9718:Tcerg1 UTSW 18 42,663,836 (GRCm39) missense unknown
R9781:Tcerg1 UTSW 18 42,701,030 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGGCTGGTAGCATACACTCAC -3'
(R):5'- AGTTCCAGGTTGACAAGGCACC -3'

Sequencing Primer
(F):5'- GGGACCCGAATGTCTGTG -3'
(R):5'- CAGGTTGACAAGGCACCTTATTTATC -3'
Posted On 2013-05-23