Incidental Mutation 'R0483:Speg'
ID 42087
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene Name SPEG complex locus
Synonyms SPEG, SPEGalpha, SPEGbeta, Apeg1, BPEG, D1Bwg1450e
MMRRC Submission 038683-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0483 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 75351941-75408964 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75361676 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 230 (E230G)
Ref Sequence ENSEMBL: ENSMUSP00000084361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087122] [ENSMUST00000113590] [ENSMUST00000125306] [ENSMUST00000148515]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000087122
AA Change: E230G

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: E230G

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113590
AA Change: E124G

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109220
Gene: ENSMUSG00000026207
AA Change: E124G

DomainStartEndE-ValueType
low complexity region 186 212 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 253 262 N/A INTRINSIC
low complexity region 306 317 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
IGc2 633 700 2.19e-9 SMART
low complexity region 752 764 N/A INTRINSIC
IGc2 780 848 4.03e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125118
Predicted Effect probably benign
Transcript: ENSMUST00000125306
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132222
Predicted Effect unknown
Transcript: ENSMUST00000132228
AA Change: E68G
Predicted Effect probably benign
Transcript: ENSMUST00000137868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146705
Predicted Effect probably benign
Transcript: ENSMUST00000148515
SMART Domains Protein: ENSMUSP00000116953
Gene: ENSMUSG00000026207

DomainStartEndE-ValueType
low complexity region 113 126 N/A INTRINSIC
low complexity region 137 163 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 204 213 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187214
Meta Mutation Damage Score 0.0781 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik G A 10: 83,595,502 (GRCm39) probably benign Het
1700048O20Rik A T 9: 121,769,769 (GRCm39) noncoding transcript Het
AA986860 A G 1: 130,671,562 (GRCm39) R595G probably damaging Het
Acrbp C A 6: 125,031,759 (GRCm39) F353L possibly damaging Het
Adamts20 T A 15: 94,251,452 (GRCm39) Q445L probably benign Het
Adgrg5 A G 8: 95,660,136 (GRCm39) D26G possibly damaging Het
Atad2b A T 12: 4,995,035 (GRCm39) probably benign Het
Atg2a G T 19: 6,306,631 (GRCm39) G1439C probably damaging Het
Atg2a G T 19: 6,306,632 (GRCm39) G1439V probably benign Het
B3galt1 G A 2: 67,948,932 (GRCm39) V216I probably benign Het
Bmerb1 T C 16: 13,913,803 (GRCm39) *113R probably null Het
C2cd2 A G 16: 97,660,788 (GRCm39) probably benign Het
Cacna2d1 G A 5: 16,564,025 (GRCm39) V884M probably damaging Het
Cers5 C A 15: 99,643,795 (GRCm39) C22F probably damaging Het
Ces1d C A 8: 93,924,307 (GRCm39) C14F probably benign Het
Cntn3 G T 6: 102,180,927 (GRCm39) P756Q probably damaging Het
Col4a1 T C 8: 11,286,423 (GRCm39) probably benign Het
Col5a3 A G 9: 20,693,777 (GRCm39) probably null Het
Cox5b G A 1: 36,731,636 (GRCm39) probably null Het
Cwc27 C A 13: 104,947,724 (GRCm39) probably null Het
Cyp27b1 A C 10: 126,886,026 (GRCm39) M260L probably benign Het
Ddx19b A T 8: 111,735,310 (GRCm39) N465K probably benign Het
Depdc1b T C 13: 108,510,382 (GRCm39) V298A probably benign Het
Dnaaf1 A G 8: 120,317,405 (GRCm39) I311M possibly damaging Het
Dnah17 T C 11: 117,937,950 (GRCm39) N3372S probably benign Het
Dus4l G A 12: 31,691,656 (GRCm39) T184I possibly damaging Het
Dzip3 T C 16: 48,768,076 (GRCm39) K453E possibly damaging Het
Fhod3 C T 18: 24,842,673 (GRCm39) T3M probably damaging Het
Galnt10 T C 11: 57,672,048 (GRCm39) L446P probably damaging Het
Gfod1 T A 13: 43,354,012 (GRCm39) D321V possibly damaging Het
Glt8d2 C A 10: 82,497,987 (GRCm39) probably benign Het
Gm11115 A G 5: 88,301,948 (GRCm39) M4T unknown Het
Gm11568 G A 11: 99,749,209 (GRCm39) C138Y unknown Het
Gm57859 C T 11: 113,580,021 (GRCm39) T472I possibly damaging Het
Gm9742 A G 13: 8,085,052 (GRCm39) noncoding transcript Het
Gnrhr G T 5: 86,345,434 (GRCm39) T84N probably damaging Het
Gpr176 C A 2: 118,110,204 (GRCm39) G352W probably damaging Het
Habp2 T C 19: 56,304,864 (GRCm39) probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Inpp5j C G 11: 3,449,738 (GRCm39) W681C probably damaging Het
Insl6 A G 19: 29,298,968 (GRCm39) M148T probably benign Het
Itgb1 T G 8: 129,452,648 (GRCm39) M771R possibly damaging Het
Kank1 G T 19: 25,403,357 (GRCm39) probably benign Het
Kcnd3 T C 3: 105,366,942 (GRCm39) Y271H probably damaging Het
Kcnq4 C A 4: 120,573,798 (GRCm39) R221L probably damaging Het
Klk1b26 G A 7: 43,665,772 (GRCm39) V195I probably benign Het
Lactb A C 9: 66,878,145 (GRCm39) V228G possibly damaging Het
Ldb3 T C 14: 34,258,541 (GRCm39) D649G probably damaging Het
Lilra6 T A 7: 3,916,138 (GRCm39) R240S probably benign Het
Lrp2 A G 2: 69,338,145 (GRCm39) Y1212H probably damaging Het
Mapk8ip1 A T 2: 92,216,321 (GRCm39) probably null Het
Mctp1 C T 13: 76,975,846 (GRCm39) L483F probably damaging Het
Mmp16 T C 4: 18,115,878 (GRCm39) probably benign Het
Mphosph9 A T 5: 124,445,033 (GRCm39) L360* probably null Het
Myh4 A G 11: 67,143,123 (GRCm39) E1017G probably damaging Het
Nell1 A T 7: 49,879,928 (GRCm39) M307L probably benign Het
Or10al3 C T 17: 38,012,188 (GRCm39) A209V probably benign Het
Or10d1 A C 9: 39,484,139 (GRCm39) C139G probably damaging Het
Or5m11 A G 2: 85,781,587 (GRCm39) Y60C probably damaging Het
Or8k35 A G 2: 86,424,752 (GRCm39) V140A probably benign Het
Phc2 A G 4: 128,617,100 (GRCm39) probably benign Het
Pp2d1 C A 17: 53,814,999 (GRCm39) C575F probably benign Het
Ptpra T A 2: 130,381,605 (GRCm39) N364K probably damaging Het
R3hcc1l A G 19: 42,550,995 (GRCm39) probably benign Het
Rims1 A G 1: 22,507,263 (GRCm39) probably benign Het
Shank3 G A 15: 89,427,442 (GRCm39) probably benign Het
Sit1 T A 4: 43,482,991 (GRCm39) Q86L possibly damaging Het
Skint4 C A 4: 111,975,136 (GRCm39) probably benign Het
Skint8 G T 4: 111,796,020 (GRCm39) probably benign Het
Smim13 T C 13: 41,426,186 (GRCm39) I74T probably benign Het
Sp110 C G 1: 85,516,839 (GRCm39) E219D probably damaging Het
Spmap2l A G 5: 77,185,204 (GRCm39) probably benign Het
Srpra A G 9: 35,127,291 (GRCm39) T614A possibly damaging Het
Synpo2 T C 3: 122,907,981 (GRCm39) D445G probably damaging Het
Tas2r102 A T 6: 132,739,328 (GRCm39) I79F probably damaging Het
Tmc4 A G 7: 3,670,609 (GRCm39) L494P probably damaging Het
Togaram1 G T 12: 65,053,805 (GRCm39) V1412F probably damaging Het
Topors T C 4: 40,261,952 (GRCm39) D444G probably damaging Het
Trappc8 T A 18: 20,978,658 (GRCm39) I813F possibly damaging Het
Trim26 T C 17: 37,163,598 (GRCm39) probably benign Het
Unc13a T C 8: 72,097,557 (GRCm39) D1171G probably damaging Het
Usp7 A G 16: 8,517,126 (GRCm39) V245A probably damaging Het
Vmn1r38 T A 6: 66,753,979 (GRCm39) T46S probably benign Het
Vmn2r76 T C 7: 85,874,959 (GRCm39) T673A probably damaging Het
Zcchc14 T A 8: 122,355,388 (GRCm39) probably benign Het
Zfp451 T A 1: 33,809,991 (GRCm39) probably benign Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75,387,034 (GRCm39) missense possibly damaging 0.95
IGL00979:Speg APN 1 75,387,378 (GRCm39) missense probably damaging 0.98
IGL01122:Speg APN 1 75,386,679 (GRCm39) missense probably damaging 1.00
IGL01293:Speg APN 1 75,364,746 (GRCm39) missense probably damaging 1.00
IGL01304:Speg APN 1 75,404,841 (GRCm39) missense probably benign 0.00
IGL01351:Speg APN 1 75,387,920 (GRCm39) splice site probably benign
IGL01473:Speg APN 1 75,404,929 (GRCm39) missense possibly damaging 0.53
IGL01477:Speg APN 1 75,368,541 (GRCm39) missense probably damaging 1.00
IGL01485:Speg APN 1 75,364,471 (GRCm39) missense probably damaging 1.00
IGL01584:Speg APN 1 75,407,581 (GRCm39) missense probably damaging 1.00
IGL01959:Speg APN 1 75,367,734 (GRCm39) missense probably damaging 1.00
IGL02231:Speg APN 1 75,400,031 (GRCm39) missense probably damaging 1.00
IGL02355:Speg APN 1 75,400,559 (GRCm39) missense possibly damaging 0.49
IGL02362:Speg APN 1 75,400,559 (GRCm39) missense possibly damaging 0.49
IGL03013:Speg APN 1 75,407,923 (GRCm39) missense probably damaging 0.97
IGL03168:Speg APN 1 75,364,831 (GRCm39) missense probably damaging 1.00
H8562:Speg UTSW 1 75,392,241 (GRCm39) missense probably benign 0.39
R0112:Speg UTSW 1 75,361,676 (GRCm39) missense possibly damaging 0.92
R0311:Speg UTSW 1 75,407,581 (GRCm39) missense probably damaging 1.00
R0315:Speg UTSW 1 75,391,780 (GRCm39) missense possibly damaging 0.88
R0393:Speg UTSW 1 75,400,568 (GRCm39) missense possibly damaging 0.46
R0403:Speg UTSW 1 75,407,428 (GRCm39) splice site probably benign
R0648:Speg UTSW 1 75,404,622 (GRCm39) missense probably benign
R0683:Speg UTSW 1 75,405,762 (GRCm39) missense probably damaging 1.00
R0800:Speg UTSW 1 75,400,133 (GRCm39) missense probably damaging 1.00
R0815:Speg UTSW 1 75,392,036 (GRCm39) missense probably damaging 1.00
R0835:Speg UTSW 1 75,352,318 (GRCm39) missense probably benign 0.00
R0866:Speg UTSW 1 75,393,727 (GRCm39) missense probably damaging 0.99
R0880:Speg UTSW 1 75,381,705 (GRCm39) missense probably damaging 1.00
R1082:Speg UTSW 1 75,391,782 (GRCm39) missense possibly damaging 0.94
R1140:Speg UTSW 1 75,405,739 (GRCm39) missense probably damaging 1.00
R1252:Speg UTSW 1 75,403,739 (GRCm39) missense probably damaging 1.00
R1301:Speg UTSW 1 75,378,145 (GRCm39) missense probably damaging 1.00
R1348:Speg UTSW 1 75,399,516 (GRCm39) missense probably damaging 0.99
R1388:Speg UTSW 1 75,407,104 (GRCm39) missense probably damaging 0.99
R1465:Speg UTSW 1 75,405,128 (GRCm39) splice site probably benign
R1505:Speg UTSW 1 75,352,186 (GRCm39) missense probably benign 0.02
R1506:Speg UTSW 1 75,394,307 (GRCm39) missense probably benign 0.03
R1531:Speg UTSW 1 75,377,866 (GRCm39) missense possibly damaging 0.86
R1543:Speg UTSW 1 75,398,595 (GRCm39) missense probably damaging 1.00
R1567:Speg UTSW 1 75,404,691 (GRCm39) missense probably benign
R1630:Speg UTSW 1 75,399,621 (GRCm39) missense probably damaging 1.00
R1667:Speg UTSW 1 75,387,193 (GRCm39) splice site probably benign
R1673:Speg UTSW 1 75,387,807 (GRCm39) missense possibly damaging 0.60
R1718:Speg UTSW 1 75,398,388 (GRCm39) missense possibly damaging 0.87
R1718:Speg UTSW 1 75,394,507 (GRCm39) missense probably benign 0.00
R1719:Speg UTSW 1 75,394,507 (GRCm39) missense probably benign 0.00
R1759:Speg UTSW 1 75,377,806 (GRCm39) missense possibly damaging 0.95
R1861:Speg UTSW 1 75,365,649 (GRCm39) missense probably damaging 1.00
R1874:Speg UTSW 1 75,400,550 (GRCm39) missense probably benign
R1936:Speg UTSW 1 75,408,052 (GRCm39) missense possibly damaging 0.93
R2192:Speg UTSW 1 75,394,371 (GRCm39) missense probably damaging 1.00
R2204:Speg UTSW 1 75,407,121 (GRCm39) missense probably benign 0.30
R2287:Speg UTSW 1 75,407,109 (GRCm39) missense possibly damaging 0.76
R2696:Speg UTSW 1 75,383,570 (GRCm39) missense probably benign 0.27
R2983:Speg UTSW 1 75,361,574 (GRCm39) missense possibly damaging 0.83
R3110:Speg UTSW 1 75,399,326 (GRCm39) nonsense probably null
R3112:Speg UTSW 1 75,399,326 (GRCm39) nonsense probably null
R3154:Speg UTSW 1 75,378,186 (GRCm39) missense probably damaging 1.00
R3720:Speg UTSW 1 75,403,426 (GRCm39) missense probably damaging 1.00
R3983:Speg UTSW 1 75,399,191 (GRCm39) missense probably benign 0.27
R4133:Speg UTSW 1 75,404,548 (GRCm39) missense probably benign
R4522:Speg UTSW 1 75,404,974 (GRCm39) missense probably damaging 1.00
R4564:Speg UTSW 1 75,368,478 (GRCm39) missense probably damaging 1.00
R4577:Speg UTSW 1 75,392,039 (GRCm39) missense probably damaging 1.00
R4858:Speg UTSW 1 75,398,379 (GRCm39) missense probably damaging 1.00
R4953:Speg UTSW 1 75,400,508 (GRCm39) missense possibly damaging 0.72
R4965:Speg UTSW 1 75,404,347 (GRCm39) missense probably damaging 1.00
R4967:Speg UTSW 1 75,364,513 (GRCm39) missense probably damaging 1.00
R5152:Speg UTSW 1 75,404,742 (GRCm39) missense possibly damaging 0.92
R5156:Speg UTSW 1 75,404,731 (GRCm39) missense probably damaging 0.99
R5371:Speg UTSW 1 75,408,037 (GRCm39) missense possibly damaging 0.50
R5550:Speg UTSW 1 75,405,744 (GRCm39) missense probably damaging 1.00
R5562:Speg UTSW 1 75,403,700 (GRCm39) missense probably damaging 1.00
R5687:Speg UTSW 1 75,395,773 (GRCm39) splice site probably null
R5985:Speg UTSW 1 75,383,328 (GRCm39) missense possibly damaging 0.94
R6004:Speg UTSW 1 75,392,247 (GRCm39) nonsense probably null
R6038:Speg UTSW 1 75,395,103 (GRCm39) critical splice donor site probably null
R6038:Speg UTSW 1 75,395,103 (GRCm39) critical splice donor site probably null
R6143:Speg UTSW 1 75,391,031 (GRCm39) missense probably damaging 1.00
R6265:Speg UTSW 1 75,383,323 (GRCm39) nonsense probably null
R6347:Speg UTSW 1 75,403,519 (GRCm39) missense probably benign 0.00
R6453:Speg UTSW 1 75,394,616 (GRCm39) missense probably benign 0.06
R6505:Speg UTSW 1 75,406,167 (GRCm39) missense possibly damaging 0.93
R6505:Speg UTSW 1 75,383,328 (GRCm39) missense possibly damaging 0.94
R6531:Speg UTSW 1 75,399,401 (GRCm39) missense probably benign 0.03
R6566:Speg UTSW 1 75,365,107 (GRCm39) missense probably damaging 1.00
R6747:Speg UTSW 1 75,387,039 (GRCm39) critical splice donor site probably null
R6819:Speg UTSW 1 75,368,456 (GRCm39) missense possibly damaging 0.56
R6821:Speg UTSW 1 75,394,547 (GRCm39) missense possibly damaging 0.83
R6919:Speg UTSW 1 75,364,552 (GRCm39) nonsense probably null
R6981:Speg UTSW 1 75,407,557 (GRCm39) missense probably damaging 1.00
R7002:Speg UTSW 1 75,399,912 (GRCm39) missense probably damaging 0.98
R7082:Speg UTSW 1 75,388,091 (GRCm39) missense probably damaging 0.96
R7140:Speg UTSW 1 75,383,414 (GRCm39) critical splice donor site probably null
R7175:Speg UTSW 1 75,399,134 (GRCm39) missense probably benign 0.01
R7178:Speg UTSW 1 75,399,027 (GRCm39) missense possibly damaging 0.46
R7345:Speg UTSW 1 75,361,479 (GRCm39) missense probably damaging 0.97
R7420:Speg UTSW 1 75,407,549 (GRCm39) missense probably damaging 1.00
R7537:Speg UTSW 1 75,378,108 (GRCm39) missense probably damaging 1.00
R7562:Speg UTSW 1 75,407,923 (GRCm39) missense probably damaging 0.97
R7615:Speg UTSW 1 75,405,886 (GRCm39) missense probably damaging 1.00
R7679:Speg UTSW 1 75,382,959 (GRCm39) missense probably damaging 1.00
R7692:Speg UTSW 1 75,377,834 (GRCm39) missense probably benign 0.04
R7696:Speg UTSW 1 75,405,805 (GRCm39) missense probably damaging 1.00
R7719:Speg UTSW 1 75,352,469 (GRCm39) missense probably damaging 1.00
R7794:Speg UTSW 1 75,365,514 (GRCm39) missense probably benign 0.00
R7824:Speg UTSW 1 75,360,661 (GRCm39) splice site probably null
R7834:Speg UTSW 1 75,361,571 (GRCm39) missense probably damaging 1.00
R7892:Speg UTSW 1 75,403,810 (GRCm39) missense probably damaging 1.00
R8015:Speg UTSW 1 75,392,065 (GRCm39) splice site probably benign
R8068:Speg UTSW 1 75,398,894 (GRCm39) missense probably damaging 1.00
R8085:Speg UTSW 1 75,391,997 (GRCm39) missense probably damaging 1.00
R8130:Speg UTSW 1 75,392,240 (GRCm39) missense probably damaging 1.00
R8132:Speg UTSW 1 75,399,639 (GRCm39) missense probably damaging 1.00
R8239:Speg UTSW 1 75,395,677 (GRCm39) missense probably damaging 1.00
R8287:Speg UTSW 1 75,398,880 (GRCm39) missense probably benign 0.26
R8299:Speg UTSW 1 75,364,480 (GRCm39) missense possibly damaging 0.95
R8441:Speg UTSW 1 75,387,976 (GRCm39) missense possibly damaging 0.60
R8468:Speg UTSW 1 75,407,953 (GRCm39) missense probably damaging 1.00
R8555:Speg UTSW 1 75,378,908 (GRCm39) splice site probably null
R8781:Speg UTSW 1 75,383,665 (GRCm39) missense probably damaging 1.00
R8784:Speg UTSW 1 75,381,793 (GRCm39) critical splice donor site probably benign
R8848:Speg UTSW 1 75,404,082 (GRCm39) critical splice donor site probably null
R8881:Speg UTSW 1 75,377,795 (GRCm39) missense possibly damaging 0.67
R8898:Speg UTSW 1 75,365,517 (GRCm39) missense probably damaging 1.00
R8935:Speg UTSW 1 75,399,250 (GRCm39) missense probably benign 0.30
R9019:Speg UTSW 1 75,405,882 (GRCm39) missense probably damaging 1.00
R9027:Speg UTSW 1 75,365,076 (GRCm39) missense possibly damaging 0.67
R9066:Speg UTSW 1 75,361,654 (GRCm39) missense probably damaging 0.99
R9092:Speg UTSW 1 75,399,378 (GRCm39) missense probably benign 0.01
R9117:Speg UTSW 1 75,364,444 (GRCm39) missense probably damaging 1.00
R9202:Speg UTSW 1 75,367,637 (GRCm39) missense probably damaging 1.00
R9246:Speg UTSW 1 75,361,498 (GRCm39) missense probably damaging 1.00
R9248:Speg UTSW 1 75,398,420 (GRCm39) missense probably damaging 1.00
R9451:Speg UTSW 1 75,394,377 (GRCm39) missense probably damaging 1.00
R9452:Speg UTSW 1 75,399,152 (GRCm39) missense probably benign
R9475:Speg UTSW 1 75,364,735 (GRCm39) missense probably damaging 1.00
R9476:Speg UTSW 1 75,377,768 (GRCm39) missense probably damaging 0.99
R9510:Speg UTSW 1 75,377,768 (GRCm39) missense probably damaging 0.99
R9519:Speg UTSW 1 75,392,380 (GRCm39) missense probably damaging 1.00
R9528:Speg UTSW 1 75,364,447 (GRCm39) missense possibly damaging 0.78
R9542:Speg UTSW 1 75,399,426 (GRCm39) missense probably benign 0.08
R9553:Speg UTSW 1 75,394,645 (GRCm39) missense probably benign 0.00
R9767:Speg UTSW 1 75,403,825 (GRCm39) missense possibly damaging 0.78
R9768:Speg UTSW 1 75,395,617 (GRCm39) nonsense probably null
R9800:Speg UTSW 1 75,399,358 (GRCm39) missense probably benign 0.03
X0025:Speg UTSW 1 75,399,101 (GRCm39) missense probably damaging 1.00
X0026:Speg UTSW 1 75,400,119 (GRCm39) missense possibly damaging 0.88
Z1176:Speg UTSW 1 75,383,238 (GRCm39) missense probably damaging 1.00
Z1177:Speg UTSW 1 75,404,327 (GRCm39) missense probably damaging 1.00
Z1177:Speg UTSW 1 75,407,099 (GRCm39) missense probably damaging 0.99
Z1177:Speg UTSW 1 75,405,025 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAAAGGGTGCTTCTGCCTCACTG -3'
(R):5'- ACCCAGGCGAGGTAACTACTTACAC -3'

Sequencing Primer
(F):5'- GGCTCTGATACCCTGGTGG -3'
(R):5'- CGTGGATCGAGAGCGCC -3'
Posted On 2013-05-23