Mutagenetix > Incidental Mutation

Incidental Mutation 'R0483:Speg'

42087

Institutional Source

Beutler Lab

Gene Symbol

Speg

Ensembl Gene

ENSMUSG00000026207

Gene Name

SPEG complex locus

Synonyms

SPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG

MMRRC Submission

038683-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0483 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75375297-75432320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75385032 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 230 (E230G)

Ref Sequence

ENSEMBL: ENSMUSP00000084361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087122] [ENSMUST00000113590] [ENSMUST00000125306] [ENSMUST00000148515]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000087122
AA Change: E230G

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: E230G

Domain	Start	End	E-Value	Type
IG	51	128	1.48e-6	SMART
low complexity region	292	318	N/A	INTRINSIC
low complexity region	325	338	N/A	INTRINSIC
low complexity region	359	368	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
IGc2	739	806	2.19e-9	SMART
Pfam:SPEG_u2	817	873	2.4e-36	PFAM
IGc2	886	954	4.03e-8	SMART
IG	979	1064	1.05e-6	SMART
IGc2	1081	1148	2.19e-9	SMART
IG	1199	1283	6.87e-2	SMART
FN3	1287	1373	1.38e-4	SMART
IG	1401	1487	2.64e-3	SMART
IGc2	1502	1569	1.12e-6	SMART
STYKc	1606	1859	8.44e-63	SMART
Blast:STYKc	1861	1895	6e-12	BLAST
low complexity region	1918	1939	N/A	INTRINSIC
low complexity region	2069	2081	N/A	INTRINSIC
low complexity region	2208	2227	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2255	2269	N/A	INTRINSIC
low complexity region	2343	2366	N/A	INTRINSIC
low complexity region	2410	2422	N/A	INTRINSIC
low complexity region	2433	2451	N/A	INTRINSIC
low complexity region	2457	2487	N/A	INTRINSIC
low complexity region	2524	2544	N/A	INTRINSIC
IGc2	2599	2667	2.05e-9	SMART
FN3	2681	2760	2.5e-2	SMART
low complexity region	2775	2789	N/A	INTRINSIC
low complexity region	2802	2831	N/A	INTRINSIC
low complexity region	2912	2927	N/A	INTRINSIC
STYKc	2961	3213	4.42e-66	SMART
low complexity region	3241	3250	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113590
AA Change: E124G

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000109220
Gene: ENSMUSG00000026207
AA Change: E124G

Domain	Start	End	E-Value	Type
low complexity region	186	212	N/A	INTRINSIC
low complexity region	219	232	N/A	INTRINSIC
low complexity region	253	262	N/A	INTRINSIC
low complexity region	306	317	N/A	INTRINSIC
low complexity region	467	478	N/A	INTRINSIC
IGc2	633	700	2.19e-9	SMART
low complexity region	752	764	N/A	INTRINSIC
IGc2	780	848	4.03e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125118

Predicted Effect

probably benign
Transcript: ENSMUST00000125306

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132222

Predicted Effect

unknown
Transcript: ENSMUST00000132228
AA Change: E68G

Predicted Effect

probably benign
Transcript: ENSMUST00000137868

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146705

Predicted Effect

probably benign
Transcript: ENSMUST00000148515

SMART Domains

Protein: ENSMUSP00000116953
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
low complexity region	113	126	N/A	INTRINSIC
low complexity region	137	163	N/A	INTRINSIC
low complexity region	170	183	N/A	INTRINSIC
low complexity region	204	213	N/A	INTRINSIC
low complexity region	257	268	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187214

Meta Mutation Damage Score

0.0781

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

99% (89/90)

MGI Phenotype

FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1500009L16Rik	G	A	10: 83,759,638		probably benign	Het
1700048O20Rik	A	T	9: 121,940,703		noncoding transcript	Het
2900011O08Rik	T	C	16: 14,095,939	*113R	probably null	Het
AA986860	A	G	1: 130,743,825	R595G	probably damaging	Het
Acrbp	C	A	6: 125,054,796	F353L	possibly damaging	Het
Adamts20	T	A	15: 94,353,571	Q445L	probably benign	Het
Adgrg5	A	G	8: 94,933,508	D26G	possibly damaging	Het
Atad2b	A	T	12: 4,945,035		probably benign	Het
Atg2a	G	T	19: 6,256,601	G1439C	probably damaging	Het
Atg2a	G	T	19: 6,256,602	G1439V	probably benign	Het
B3galt1	G	A	2: 68,118,588	V216I	probably benign	Het
C2cd2	A	G	16: 97,859,588		probably benign	Het
Cacna2d1	G	A	5: 16,359,027	V884M	probably damaging	Het
Cers5	C	A	15: 99,745,914	C22F	probably damaging	Het
Ces1d	C	A	8: 93,197,679	C14F	probably benign	Het
Cntn3	G	T	6: 102,203,966	P756Q	probably damaging	Het
Col4a1	T	C	8: 11,236,423		probably benign	Het
Col5a3	A	G	9: 20,782,481		probably null	Het
Cox5b	G	A	1: 36,692,555		probably null	Het
Cwc27	C	A	13: 104,811,216		probably null	Het
Cyp27b1	A	C	10: 127,050,157	M260L	probably benign	Het
D11Wsu47e	C	T	11: 113,689,195	T472I	possibly damaging	Het
Ddx19b	A	T	8: 111,008,678	N465K	probably benign	Het
Depdc1b	T	C	13: 108,373,848	V298A	probably benign	Het
Dnaaf1	A	G	8: 119,590,666	I311M	possibly damaging	Het
Dnah17	T	C	11: 118,047,124	N3372S	probably benign	Het
Dus4l	G	A	12: 31,641,657	T184I	possibly damaging	Het
Dzip3	T	C	16: 48,947,713	K453E	possibly damaging	Het
Fhod3	C	T	18: 24,709,616	T3M	probably damaging	Het
Galnt10	T	C	11: 57,781,222	L446P	probably damaging	Het
Gfod1	T	A	13: 43,200,536	D321V	possibly damaging	Het
Glt8d2	C	A	10: 82,662,153		probably benign	Het
Gm11115	A	G	5: 88,154,089	M4T	unknown	Het
Gm11568	G	A	11: 99,858,383	C138Y	unknown	Het
Gm9742	A	G	13: 8,035,016		noncoding transcript	Het
Gnrhr	G	T	5: 86,197,575	T84N	probably damaging	Het
Gpr176	C	A	2: 118,279,723	G352W	probably damaging	Het
Habp2	T	C	19: 56,316,432		probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Inpp5j	C	G	11: 3,499,738	W681C	probably damaging	Het
Insl6	A	G	19: 29,321,568	M148T	probably benign	Het
Itgb1	T	G	8: 128,726,167	M771R	possibly damaging	Het
Kank1	G	T	19: 25,425,993		probably benign	Het
Kcnd3	T	C	3: 105,459,626	Y271H	probably damaging	Het
Kcnq4	C	A	4: 120,716,601	R221L	probably damaging	Het
Klk1b26	G	A	7: 44,016,348	V195I	probably benign	Het
Lactb	A	C	9: 66,970,863	V228G	possibly damaging	Het
Ldb3	T	C	14: 34,536,584	D649G	probably damaging	Het
Lilra6	T	A	7: 3,913,139	R240S	probably benign	Het
Lrp2	A	G	2: 69,507,801	Y1212H	probably damaging	Het
Mapk8ip1	A	T	2: 92,385,976		probably null	Het
Mctp1	C	T	13: 76,827,727	L483F	probably damaging	Het
Mmp16	T	C	4: 18,115,878		probably benign	Het
Mphosph9	A	T	5: 124,306,970	L360*	probably null	Het
Myh4	A	G	11: 67,252,297	E1017G	probably damaging	Het
Nell1	A	T	7: 50,230,180	M307L	probably benign	Het
Olfr1028	A	G	2: 85,951,243	Y60C	probably damaging	Het
Olfr1082	A	G	2: 86,594,408	V140A	probably benign	Het
Olfr119	C	T	17: 37,701,297	A209V	probably benign	Het
Olfr959	A	C	9: 39,572,843	C139G	probably damaging	Het
Phc2	A	G	4: 128,723,307		probably benign	Het
Pp2d1	C	A	17: 53,507,971	C575F	probably benign	Het
Ptpra	T	A	2: 130,539,685	N364K	probably damaging	Het
R3hcc1l	A	G	19: 42,562,556		probably benign	Het
Rims1	A	G	1: 22,468,182		probably benign	Het
Shank3	G	A	15: 89,543,239		probably benign	Het
Sit1	T	A	4: 43,482,991	Q86L	possibly damaging	Het
Skint4	C	A	4: 112,117,939		probably benign	Het
Skint8	G	T	4: 111,938,823		probably benign	Het
Smim13	T	C	13: 41,272,710	I74T	probably benign	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Srpr	A	G	9: 35,215,995	T614A	possibly damaging	Het
Synpo2	T	C	3: 123,114,332	D445G	probably damaging	Het
Tas2r102	A	T	6: 132,762,365	I79F	probably damaging	Het
Thegl	A	G	5: 77,037,357		probably benign	Het
Tmc4	A	G	7: 3,667,610	L494P	probably damaging	Het
Togaram1	G	T	12: 65,007,031	V1412F	probably damaging	Het
Topors	T	C	4: 40,261,952	D444G	probably damaging	Het
Trappc8	T	A	18: 20,845,601	I813F	possibly damaging	Het
Trim26	T	C	17: 36,852,706		probably benign	Het
Unc13a	T	C	8: 71,644,913	D1171G	probably damaging	Het
Usp7	A	G	16: 8,699,262	V245A	probably damaging	Het
Vmn1r38	T	A	6: 66,776,995	T46S	probably benign	Het
Vmn2r76	T	C	7: 86,225,751	T673A	probably damaging	Het
Zcchc14	T	A	8: 121,628,649		probably benign	Het
Zfp451	T	A	1: 33,770,910		probably benign	Het

Other mutations in Speg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Speg	APN	1	75410390	missense	possibly damaging	0.95
IGL00979:Speg	APN	1	75410734	missense	probably damaging	0.98
IGL01122:Speg	APN	1	75410035	missense	probably damaging	1.00
IGL01293:Speg	APN	1	75388102	missense	probably damaging	1.00
IGL01304:Speg	APN	1	75428197	missense	probably benign	0.00
IGL01351:Speg	APN	1	75411276	splice site	probably benign
IGL01473:Speg	APN	1	75428285	missense	possibly damaging	0.53
IGL01477:Speg	APN	1	75391897	missense	probably damaging	1.00
IGL01485:Speg	APN	1	75387827	missense	probably damaging	1.00
IGL01584:Speg	APN	1	75430937	missense	probably damaging	1.00
IGL01959:Speg	APN	1	75391090	missense	probably damaging	1.00
IGL02231:Speg	APN	1	75423387	missense	probably damaging	1.00
IGL02355:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL02362:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL03013:Speg	APN	1	75431279	missense	probably damaging	0.97
IGL03168:Speg	APN	1	75388187	missense	probably damaging	1.00
H8562:Speg	UTSW	1	75415597	missense	probably benign	0.39
R0112:Speg	UTSW	1	75385032	missense	possibly damaging	0.92
R0311:Speg	UTSW	1	75430937	missense	probably damaging	1.00
R0315:Speg	UTSW	1	75415136	missense	possibly damaging	0.88
R0393:Speg	UTSW	1	75423924	missense	possibly damaging	0.46
R0403:Speg	UTSW	1	75430784	splice site	probably benign
R0648:Speg	UTSW	1	75427978	missense	probably benign
R0683:Speg	UTSW	1	75429118	missense	probably damaging	1.00
R0800:Speg	UTSW	1	75423489	missense	probably damaging	1.00
R0815:Speg	UTSW	1	75415392	missense	probably damaging	1.00
R0835:Speg	UTSW	1	75375674	missense	probably benign	0.00
R0866:Speg	UTSW	1	75417083	missense	probably damaging	0.99
R0880:Speg	UTSW	1	75405061	missense	probably damaging	1.00
R1082:Speg	UTSW	1	75415138	missense	possibly damaging	0.94
R1140:Speg	UTSW	1	75429095	missense	probably damaging	1.00
R1252:Speg	UTSW	1	75427095	missense	probably damaging	1.00
R1301:Speg	UTSW	1	75401501	missense	probably damaging	1.00
R1348:Speg	UTSW	1	75422872	missense	probably damaging	0.99
R1388:Speg	UTSW	1	75430460	missense	probably damaging	0.99
R1465:Speg	UTSW	1	75428484	splice site	probably benign
R1505:Speg	UTSW	1	75375542	missense	probably benign	0.02
R1506:Speg	UTSW	1	75417663	missense	probably benign	0.03
R1531:Speg	UTSW	1	75401222	missense	possibly damaging	0.86
R1543:Speg	UTSW	1	75421951	missense	probably damaging	1.00
R1567:Speg	UTSW	1	75428047	missense	probably benign
R1630:Speg	UTSW	1	75422977	missense	probably damaging	1.00
R1667:Speg	UTSW	1	75410549	splice site	probably benign
R1673:Speg	UTSW	1	75411163	missense	possibly damaging	0.60
R1718:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1718:Speg	UTSW	1	75421744	missense	possibly damaging	0.87
R1719:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1759:Speg	UTSW	1	75401162	missense	possibly damaging	0.95
R1861:Speg	UTSW	1	75389005	missense	probably damaging	1.00
R1874:Speg	UTSW	1	75423906	missense	probably benign
R1936:Speg	UTSW	1	75431408	missense	possibly damaging	0.93
R2192:Speg	UTSW	1	75417727	missense	probably damaging	1.00
R2204:Speg	UTSW	1	75430477	missense	probably benign	0.30
R2287:Speg	UTSW	1	75430465	missense	possibly damaging	0.76
R2696:Speg	UTSW	1	75406926	missense	probably benign	0.27
R2983:Speg	UTSW	1	75384930	missense	possibly damaging	0.83
R3110:Speg	UTSW	1	75422682	nonsense	probably null
R3112:Speg	UTSW	1	75422682	nonsense	probably null
R3154:Speg	UTSW	1	75401542	missense	probably damaging	1.00
R3720:Speg	UTSW	1	75426782	missense	probably damaging	1.00
R3983:Speg	UTSW	1	75422547	missense	probably benign	0.27
R4133:Speg	UTSW	1	75427904	missense	probably benign
R4522:Speg	UTSW	1	75428330	missense	probably damaging	1.00
R4564:Speg	UTSW	1	75391834	missense	probably damaging	1.00
R4577:Speg	UTSW	1	75415395	missense	probably damaging	1.00
R4858:Speg	UTSW	1	75421735	missense	probably damaging	1.00
R4953:Speg	UTSW	1	75423864	missense	possibly damaging	0.72
R4965:Speg	UTSW	1	75427703	missense	probably damaging	1.00
R4967:Speg	UTSW	1	75387869	missense	probably damaging	1.00
R5152:Speg	UTSW	1	75428098	missense	possibly damaging	0.92
R5156:Speg	UTSW	1	75428087	missense	probably damaging	0.99
R5371:Speg	UTSW	1	75431393	missense	possibly damaging	0.50
R5550:Speg	UTSW	1	75429100	missense	probably damaging	1.00
R5562:Speg	UTSW	1	75427056	missense	probably damaging	1.00
R5687:Speg	UTSW	1	75419129	splice site	probably null
R5985:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6004:Speg	UTSW	1	75415603	nonsense	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6143:Speg	UTSW	1	75414387	missense	probably damaging	1.00
R6265:Speg	UTSW	1	75406679	nonsense	probably null
R6347:Speg	UTSW	1	75426875	missense	probably benign	0.00
R6453:Speg	UTSW	1	75417972	missense	probably benign	0.06
R6505:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6505:Speg	UTSW	1	75429523	missense	possibly damaging	0.93
R6531:Speg	UTSW	1	75422757	missense	probably benign	0.03
R6566:Speg	UTSW	1	75388463	missense	probably damaging	1.00
R6747:Speg	UTSW	1	75410395	critical splice donor site	probably null
R6819:Speg	UTSW	1	75391812	missense	possibly damaging	0.56
R6821:Speg	UTSW	1	75417903	missense	possibly damaging	0.83
R6919:Speg	UTSW	1	75387908	nonsense	probably null
R6981:Speg	UTSW	1	75430913	missense	probably damaging	1.00
R7002:Speg	UTSW	1	75423268	missense	probably damaging	0.98
R7082:Speg	UTSW	1	75411447	missense	probably damaging	0.96
R7140:Speg	UTSW	1	75406770	critical splice donor site	probably null
R7175:Speg	UTSW	1	75422490	missense	probably benign	0.01
R7178:Speg	UTSW	1	75422383	missense	possibly damaging	0.46
R7345:Speg	UTSW	1	75384835	missense	probably damaging	0.97
R7420:Speg	UTSW	1	75430905	missense	probably damaging	1.00
R7537:Speg	UTSW	1	75401464	missense	probably damaging	1.00
R7562:Speg	UTSW	1	75431279	missense	probably damaging	0.97
R7615:Speg	UTSW	1	75429242	missense	probably damaging	1.00
R7679:Speg	UTSW	1	75406315	missense	probably damaging	1.00
R7692:Speg	UTSW	1	75401190	missense	probably benign	0.04
R7696:Speg	UTSW	1	75429161	missense	probably damaging	1.00
R7719:Speg	UTSW	1	75375825	missense	probably damaging	1.00
R7794:Speg	UTSW	1	75388870	missense	probably benign	0.00
R7824:Speg	UTSW	1	75384017	splice site	probably null
R7834:Speg	UTSW	1	75384927	missense	probably damaging	1.00
R7892:Speg	UTSW	1	75427166	missense	probably damaging	1.00
R8015:Speg	UTSW	1	75415421	splice site	probably benign
R8068:Speg	UTSW	1	75422250	missense	probably damaging	1.00
R8085:Speg	UTSW	1	75415353	missense	probably damaging	1.00
R8130:Speg	UTSW	1	75415596	missense	probably damaging	1.00
R8132:Speg	UTSW	1	75422995	missense	probably damaging	1.00
R8239:Speg	UTSW	1	75419033	missense	probably damaging	1.00
R8287:Speg	UTSW	1	75422236	missense	probably benign	0.26
R8299:Speg	UTSW	1	75387836	missense	possibly damaging	0.95
R8441:Speg	UTSW	1	75411332	missense	possibly damaging	0.60
R8468:Speg	UTSW	1	75431309	missense	probably damaging	1.00
R8555:Speg	UTSW	1	75402264	splice site	probably null
R8781:Speg	UTSW	1	75407021	missense	probably damaging	1.00
R8784:Speg	UTSW	1	75405149	critical splice donor site	probably benign
R8848:Speg	UTSW	1	75427438	critical splice donor site	probably null
R8881:Speg	UTSW	1	75401151	missense	possibly damaging	0.67
R8898:Speg	UTSW	1	75388873	missense	probably damaging	1.00
R8935:Speg	UTSW	1	75422606	missense	probably benign	0.30
R9019:Speg	UTSW	1	75429238	missense	probably damaging	1.00
R9027:Speg	UTSW	1	75388432	missense	possibly damaging	0.67
R9066:Speg	UTSW	1	75385010	missense	probably damaging	0.99
R9092:Speg	UTSW	1	75422734	missense	probably benign	0.01
R9117:Speg	UTSW	1	75387800	missense	probably damaging	1.00
R9202:Speg	UTSW	1	75390993	missense	probably damaging	1.00
R9246:Speg	UTSW	1	75384854	missense	probably damaging	1.00
R9248:Speg	UTSW	1	75421776	missense	probably damaging	1.00
R9451:Speg	UTSW	1	75417733	missense	probably damaging	1.00
R9452:Speg	UTSW	1	75422508	missense	probably benign
R9475:Speg	UTSW	1	75388091	missense	probably damaging	1.00
R9476:Speg	UTSW	1	75401124	missense	probably damaging	0.99
R9510:Speg	UTSW	1	75401124	missense	probably damaging	0.99
R9519:Speg	UTSW	1	75415736	missense	probably damaging	1.00
R9528:Speg	UTSW	1	75387803	missense	possibly damaging	0.78
R9542:Speg	UTSW	1	75422782	missense	probably benign	0.08
R9553:Speg	UTSW	1	75418001	missense	probably benign	0.00
R9767:Speg	UTSW	1	75427181	missense	possibly damaging	0.78
R9768:Speg	UTSW	1	75418973	nonsense	probably null
R9800:Speg	UTSW	1	75422714	missense	probably benign	0.03
X0025:Speg	UTSW	1	75422457	missense	probably damaging	1.00
X0026:Speg	UTSW	1	75423475	missense	possibly damaging	0.88
Z1176:Speg	UTSW	1	75406594	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75427683	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75428381	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75430455	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TACAAAGGGTGCTTCTGCCTCACTG -3'
(R):5'- ACCCAGGCGAGGTAACTACTTACAC -3'

Sequencing Primer
(F):5'- GGCTCTGATACCCTGGTGG -3'
(R):5'- CGTGGATCGAGAGCGCC -3'

Posted On

2013-05-23