Incidental Mutation 'R0483:AA986860'
ID 42088
Institutional Source Beutler Lab
Gene Symbol AA986860
Ensembl Gene ENSMUSG00000042510
Gene Name expressed sequence AA986860
Synonyms
MMRRC Submission 038683-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R0483 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 130659713-130672359 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 130671562 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 595 (R595G)
Ref Sequence ENSEMBL: ENSMUSP00000046172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039323]
AlphaFold Q8BI29
Predicted Effect probably damaging
Transcript: ENSMUST00000039323
AA Change: R595G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046172
Gene: ENSMUSG00000042510
AA Change: R595G

DomainStartEndE-ValueType
Pfam:SARG 33 606 1e-235 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190859
Meta Mutation Damage Score 0.3334 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 99% (89/90)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik G A 10: 83,595,502 (GRCm39) probably benign Het
1700048O20Rik A T 9: 121,769,769 (GRCm39) noncoding transcript Het
Acrbp C A 6: 125,031,759 (GRCm39) F353L possibly damaging Het
Adamts20 T A 15: 94,251,452 (GRCm39) Q445L probably benign Het
Adgrg5 A G 8: 95,660,136 (GRCm39) D26G possibly damaging Het
Atad2b A T 12: 4,995,035 (GRCm39) probably benign Het
Atg2a G T 19: 6,306,631 (GRCm39) G1439C probably damaging Het
Atg2a G T 19: 6,306,632 (GRCm39) G1439V probably benign Het
B3galt1 G A 2: 67,948,932 (GRCm39) V216I probably benign Het
Bmerb1 T C 16: 13,913,803 (GRCm39) *113R probably null Het
C2cd2 A G 16: 97,660,788 (GRCm39) probably benign Het
Cacna2d1 G A 5: 16,564,025 (GRCm39) V884M probably damaging Het
Cers5 C A 15: 99,643,795 (GRCm39) C22F probably damaging Het
Ces1d C A 8: 93,924,307 (GRCm39) C14F probably benign Het
Cntn3 G T 6: 102,180,927 (GRCm39) P756Q probably damaging Het
Col4a1 T C 8: 11,286,423 (GRCm39) probably benign Het
Col5a3 A G 9: 20,693,777 (GRCm39) probably null Het
Cox5b G A 1: 36,731,636 (GRCm39) probably null Het
Cwc27 C A 13: 104,947,724 (GRCm39) probably null Het
Cyp27b1 A C 10: 126,886,026 (GRCm39) M260L probably benign Het
Ddx19b A T 8: 111,735,310 (GRCm39) N465K probably benign Het
Depdc1b T C 13: 108,510,382 (GRCm39) V298A probably benign Het
Dnaaf1 A G 8: 120,317,405 (GRCm39) I311M possibly damaging Het
Dnah17 T C 11: 117,937,950 (GRCm39) N3372S probably benign Het
Dus4l G A 12: 31,691,656 (GRCm39) T184I possibly damaging Het
Dzip3 T C 16: 48,768,076 (GRCm39) K453E possibly damaging Het
Fhod3 C T 18: 24,842,673 (GRCm39) T3M probably damaging Het
Galnt10 T C 11: 57,672,048 (GRCm39) L446P probably damaging Het
Gfod1 T A 13: 43,354,012 (GRCm39) D321V possibly damaging Het
Glt8d2 C A 10: 82,497,987 (GRCm39) probably benign Het
Gm11115 A G 5: 88,301,948 (GRCm39) M4T unknown Het
Gm11568 G A 11: 99,749,209 (GRCm39) C138Y unknown Het
Gm57859 C T 11: 113,580,021 (GRCm39) T472I possibly damaging Het
Gm9742 A G 13: 8,085,052 (GRCm39) noncoding transcript Het
Gnrhr G T 5: 86,345,434 (GRCm39) T84N probably damaging Het
Gpr176 C A 2: 118,110,204 (GRCm39) G352W probably damaging Het
Habp2 T C 19: 56,304,864 (GRCm39) probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Inpp5j C G 11: 3,449,738 (GRCm39) W681C probably damaging Het
Insl6 A G 19: 29,298,968 (GRCm39) M148T probably benign Het
Itgb1 T G 8: 129,452,648 (GRCm39) M771R possibly damaging Het
Kank1 G T 19: 25,403,357 (GRCm39) probably benign Het
Kcnd3 T C 3: 105,366,942 (GRCm39) Y271H probably damaging Het
Kcnq4 C A 4: 120,573,798 (GRCm39) R221L probably damaging Het
Klk1b26 G A 7: 43,665,772 (GRCm39) V195I probably benign Het
Lactb A C 9: 66,878,145 (GRCm39) V228G possibly damaging Het
Ldb3 T C 14: 34,258,541 (GRCm39) D649G probably damaging Het
Lilra6 T A 7: 3,916,138 (GRCm39) R240S probably benign Het
Lrp2 A G 2: 69,338,145 (GRCm39) Y1212H probably damaging Het
Mapk8ip1 A T 2: 92,216,321 (GRCm39) probably null Het
Mctp1 C T 13: 76,975,846 (GRCm39) L483F probably damaging Het
Mmp16 T C 4: 18,115,878 (GRCm39) probably benign Het
Mphosph9 A T 5: 124,445,033 (GRCm39) L360* probably null Het
Myh4 A G 11: 67,143,123 (GRCm39) E1017G probably damaging Het
Nell1 A T 7: 49,879,928 (GRCm39) M307L probably benign Het
Or10al3 C T 17: 38,012,188 (GRCm39) A209V probably benign Het
Or10d1 A C 9: 39,484,139 (GRCm39) C139G probably damaging Het
Or5m11 A G 2: 85,781,587 (GRCm39) Y60C probably damaging Het
Or8k35 A G 2: 86,424,752 (GRCm39) V140A probably benign Het
Phc2 A G 4: 128,617,100 (GRCm39) probably benign Het
Pp2d1 C A 17: 53,814,999 (GRCm39) C575F probably benign Het
Ptpra T A 2: 130,381,605 (GRCm39) N364K probably damaging Het
R3hcc1l A G 19: 42,550,995 (GRCm39) probably benign Het
Rims1 A G 1: 22,507,263 (GRCm39) probably benign Het
Shank3 G A 15: 89,427,442 (GRCm39) probably benign Het
Sit1 T A 4: 43,482,991 (GRCm39) Q86L possibly damaging Het
Skint4 C A 4: 111,975,136 (GRCm39) probably benign Het
Skint8 G T 4: 111,796,020 (GRCm39) probably benign Het
Smim13 T C 13: 41,426,186 (GRCm39) I74T probably benign Het
Sp110 C G 1: 85,516,839 (GRCm39) E219D probably damaging Het
Speg A G 1: 75,361,676 (GRCm39) E230G possibly damaging Het
Spmap2l A G 5: 77,185,204 (GRCm39) probably benign Het
Srpra A G 9: 35,127,291 (GRCm39) T614A possibly damaging Het
Synpo2 T C 3: 122,907,981 (GRCm39) D445G probably damaging Het
Tas2r102 A T 6: 132,739,328 (GRCm39) I79F probably damaging Het
Tmc4 A G 7: 3,670,609 (GRCm39) L494P probably damaging Het
Togaram1 G T 12: 65,053,805 (GRCm39) V1412F probably damaging Het
Topors T C 4: 40,261,952 (GRCm39) D444G probably damaging Het
Trappc8 T A 18: 20,978,658 (GRCm39) I813F possibly damaging Het
Trim26 T C 17: 37,163,598 (GRCm39) probably benign Het
Unc13a T C 8: 72,097,557 (GRCm39) D1171G probably damaging Het
Usp7 A G 16: 8,517,126 (GRCm39) V245A probably damaging Het
Vmn1r38 T A 6: 66,753,979 (GRCm39) T46S probably benign Het
Vmn2r76 T C 7: 85,874,959 (GRCm39) T673A probably damaging Het
Zcchc14 T A 8: 122,355,388 (GRCm39) probably benign Het
Zfp451 T A 1: 33,809,991 (GRCm39) probably benign Het
Other mutations in AA986860
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:AA986860 APN 1 130,670,573 (GRCm39) missense possibly damaging 0.69
IGL01761:AA986860 APN 1 130,670,459 (GRCm39) missense possibly damaging 0.70
IGL02557:AA986860 APN 1 130,670,444 (GRCm39) missense probably benign 0.02
IGL03003:AA986860 APN 1 130,671,509 (GRCm39) missense probably damaging 1.00
IGL02802:AA986860 UTSW 1 130,671,130 (GRCm39) missense probably benign 0.00
R0326:AA986860 UTSW 1 130,670,635 (GRCm39) missense possibly damaging 0.87
R0906:AA986860 UTSW 1 130,665,430 (GRCm39) splice site probably benign
R0932:AA986860 UTSW 1 130,665,430 (GRCm39) splice site probably null
R1522:AA986860 UTSW 1 130,670,831 (GRCm39) missense probably damaging 1.00
R1762:AA986860 UTSW 1 130,665,425 (GRCm39) critical splice donor site probably null
R1874:AA986860 UTSW 1 130,670,428 (GRCm39) missense probably benign 0.06
R2083:AA986860 UTSW 1 130,668,806 (GRCm39) missense probably damaging 1.00
R2091:AA986860 UTSW 1 130,670,906 (GRCm39) missense probably benign 0.01
R2093:AA986860 UTSW 1 130,671,041 (GRCm39) missense probably benign 0.13
R3546:AA986860 UTSW 1 130,668,926 (GRCm39) splice site probably benign
R3915:AA986860 UTSW 1 130,670,344 (GRCm39) missense probably benign
R4679:AA986860 UTSW 1 130,670,140 (GRCm39) missense possibly damaging 0.67
R4703:AA986860 UTSW 1 130,671,092 (GRCm39) missense probably benign 0.19
R4890:AA986860 UTSW 1 130,668,725 (GRCm39) splice site probably benign
R4988:AA986860 UTSW 1 130,670,447 (GRCm39) missense probably damaging 1.00
R5171:AA986860 UTSW 1 130,670,584 (GRCm39) missense probably benign 0.23
R5327:AA986860 UTSW 1 130,668,740 (GRCm39) missense probably damaging 1.00
R5424:AA986860 UTSW 1 130,670,678 (GRCm39) missense probably damaging 1.00
R5763:AA986860 UTSW 1 130,670,768 (GRCm39) missense possibly damaging 0.53
R5799:AA986860 UTSW 1 130,668,908 (GRCm39) nonsense probably null
R6247:AA986860 UTSW 1 130,670,780 (GRCm39) missense possibly damaging 0.78
R7124:AA986860 UTSW 1 130,670,624 (GRCm39) missense possibly damaging 0.67
R7747:AA986860 UTSW 1 130,671,284 (GRCm39) missense possibly damaging 0.60
Z1176:AA986860 UTSW 1 130,670,728 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AAGGTTTCACCCAGCGCCTTTC -3'
(R):5'- TGGGACAGGCTGAACTTTGCAC -3'

Sequencing Primer
(F):5'- CCAGCGCCTTTCGTAATTC -3'
(R):5'- ctctctctctctctctctctcc -3'
Posted On 2013-05-23