Incidental Mutation 'R0483:Kcnd3'
ID42096
Institutional Source Beutler Lab
Gene Symbol Kcnd3
Ensembl Gene ENSMUSG00000040896
Gene Namepotassium voltage-gated channel, Shal-related family, member 3
SynonymsKv4.3, potassium channel Kv4.3M, potassium channel Kv4.3L
MMRRC Submission 038683-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0483 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location105452330-105674002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105459626 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 271 (Y271H)
Ref Sequence ENSEMBL: ENSMUSP00000113436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079169] [ENSMUST00000098761] [ENSMUST00000118360]
Predicted Effect probably damaging
Transcript: ENSMUST00000079169
AA Change: Y271H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078169
Gene: ENSMUSG00000040896
AA Change: Y271H

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 3.2e-17 PFAM
BTB 40 139 1.76e-16 SMART
Pfam:Ion_trans 182 414 6.6e-45 PFAM
Pfam:Ion_trans_2 327 408 9.5e-15 PFAM
Pfam:DUF3399 442 563 4.7e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098761
AA Change: Y271H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096357
Gene: ENSMUSG00000040896
AA Change: Y271H

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 7.3e-19 PFAM
BTB 40 139 1.76e-16 SMART
transmembrane domain 180 202 N/A INTRINSIC
Pfam:Ion_trans 228 402 1e-31 PFAM
Pfam:Ion_trans_2 327 408 8.4e-15 PFAM
low complexity region 412 431 N/A INTRINSIC
Pfam:DUF3399 442 545 9.5e-52 PFAM
low complexity region 591 606 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118360
AA Change: Y271H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113436
Gene: ENSMUSG00000040896
AA Change: Y271H

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 3.2e-17 PFAM
BTB 40 139 1.76e-16 SMART
Pfam:Ion_trans 182 414 6.6e-45 PFAM
Pfam:Ion_trans_2 327 408 9.5e-15 PFAM
Pfam:DUF3399 442 563 4.7e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141694
Meta Mutation Damage Score 0.9113 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member includes two isoforms with different sizes, which are encoded by alternatively spliced transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter (null) allele are viable and fertile and exhibit normal cardiac morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik G A 10: 83,759,638 probably benign Het
1700048O20Rik A T 9: 121,940,703 noncoding transcript Het
2900011O08Rik T C 16: 14,095,939 *113R probably null Het
AA986860 A G 1: 130,743,825 R595G probably damaging Het
Acrbp C A 6: 125,054,796 F353L possibly damaging Het
Adamts20 T A 15: 94,353,571 Q445L probably benign Het
Adgrg5 A G 8: 94,933,508 D26G possibly damaging Het
Atad2b A T 12: 4,945,035 probably benign Het
Atg2a G T 19: 6,256,601 G1439C probably damaging Het
Atg2a G T 19: 6,256,602 G1439V probably benign Het
B3galt1 G A 2: 68,118,588 V216I probably benign Het
C2cd2 A G 16: 97,859,588 probably benign Het
Cacna2d1 G A 5: 16,359,027 V884M probably damaging Het
Cers5 C A 15: 99,745,914 C22F probably damaging Het
Ces1d C A 8: 93,197,679 C14F probably benign Het
Cntn3 G T 6: 102,203,966 P756Q probably damaging Het
Col4a1 T C 8: 11,236,423 probably benign Het
Col5a3 A G 9: 20,782,481 probably null Het
Cox5b G A 1: 36,692,555 probably null Het
Cwc27 C A 13: 104,811,216 probably null Het
Cyp27b1 A C 10: 127,050,157 M260L probably benign Het
D11Wsu47e C T 11: 113,689,195 T472I possibly damaging Het
Ddx19b A T 8: 111,008,678 N465K probably benign Het
Depdc1b T C 13: 108,373,848 V298A probably benign Het
Dnaaf1 A G 8: 119,590,666 I311M possibly damaging Het
Dnah17 T C 11: 118,047,124 N3372S probably benign Het
Dus4l G A 12: 31,641,657 T184I possibly damaging Het
Dzip3 T C 16: 48,947,713 K453E possibly damaging Het
Fhod3 C T 18: 24,709,616 T3M probably damaging Het
Galnt10 T C 11: 57,781,222 L446P probably damaging Het
Gfod1 T A 13: 43,200,536 D321V possibly damaging Het
Glt8d2 C A 10: 82,662,153 probably benign Het
Gm11115 A G 5: 88,154,089 M4T unknown Het
Gm11568 G A 11: 99,858,383 C138Y unknown Het
Gm9742 A G 13: 8,035,016 noncoding transcript Het
Gnrhr G T 5: 86,197,575 T84N probably damaging Het
Gpr176 C A 2: 118,279,723 G352W probably damaging Het
Habp2 T C 19: 56,316,432 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Inpp5j C G 11: 3,499,738 W681C probably damaging Het
Insl6 A G 19: 29,321,568 M148T probably benign Het
Itgb1 T G 8: 128,726,167 M771R possibly damaging Het
Kank1 G T 19: 25,425,993 probably benign Het
Kcnq4 C A 4: 120,716,601 R221L probably damaging Het
Klk1b26 G A 7: 44,016,348 V195I probably benign Het
Lactb A C 9: 66,970,863 V228G possibly damaging Het
Ldb3 T C 14: 34,536,584 D649G probably damaging Het
Lilra6 T A 7: 3,913,139 R240S probably benign Het
Lrp2 A G 2: 69,507,801 Y1212H probably damaging Het
Mapk8ip1 A T 2: 92,385,976 probably null Het
Mctp1 C T 13: 76,827,727 L483F probably damaging Het
Mmp16 T C 4: 18,115,878 probably benign Het
Mphosph9 A T 5: 124,306,970 L360* probably null Het
Myh4 A G 11: 67,252,297 E1017G probably damaging Het
Nell1 A T 7: 50,230,180 M307L probably benign Het
Olfr1028 A G 2: 85,951,243 Y60C probably damaging Het
Olfr1082 A G 2: 86,594,408 V140A probably benign Het
Olfr119 C T 17: 37,701,297 A209V probably benign Het
Olfr959 A C 9: 39,572,843 C139G probably damaging Het
Phc2 A G 4: 128,723,307 probably benign Het
Pp2d1 C A 17: 53,507,971 C575F probably benign Het
Ptpra T A 2: 130,539,685 N364K probably damaging Het
R3hcc1l A G 19: 42,562,556 probably benign Het
Rims1 A G 1: 22,468,182 probably benign Het
Shank3 G A 15: 89,543,239 probably benign Het
Sit1 T A 4: 43,482,991 Q86L possibly damaging Het
Skint4 C A 4: 112,117,939 probably benign Het
Skint8 G T 4: 111,938,823 probably benign Het
Smim13 T C 13: 41,272,710 I74T probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Speg A G 1: 75,385,032 E230G possibly damaging Het
Srpr A G 9: 35,215,995 T614A possibly damaging Het
Synpo2 T C 3: 123,114,332 D445G probably damaging Het
Tas2r102 A T 6: 132,762,365 I79F probably damaging Het
Thegl A G 5: 77,037,357 probably benign Het
Tmc4 A G 7: 3,667,610 L494P probably damaging Het
Togaram1 G T 12: 65,007,031 V1412F probably damaging Het
Topors T C 4: 40,261,952 D444G probably damaging Het
Trappc8 T A 18: 20,845,601 I813F possibly damaging Het
Trim26 T C 17: 36,852,706 probably benign Het
Unc13a T C 8: 71,644,913 D1171G probably damaging Het
Usp7 A G 16: 8,699,262 V245A probably damaging Het
Vmn1r38 T A 6: 66,776,995 T46S probably benign Het
Vmn2r76 T C 7: 86,225,751 T673A probably damaging Het
Zcchc14 T A 8: 121,628,649 probably benign Het
Zfp451 T A 1: 33,770,910 probably benign Het
Other mutations in Kcnd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02296:Kcnd3 APN 3 105667001 nonsense probably null
PIT4498001:Kcnd3 UTSW 3 105658709 missense probably damaging 0.99
R0544:Kcnd3 UTSW 3 105658759 missense probably damaging 1.00
R1457:Kcnd3 UTSW 3 105668186 missense probably benign 0.00
R1853:Kcnd3 UTSW 3 105459752 missense probably damaging 1.00
R2030:Kcnd3 UTSW 3 105459537 missense probably damaging 1.00
R2077:Kcnd3 UTSW 3 105666999 missense probably benign 0.16
R2106:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2287:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2288:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2316:Kcnd3 UTSW 3 105669126 missense probably benign 0.17
R2909:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2924:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2925:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3014:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3016:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3038:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3696:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3697:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3698:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3777:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3778:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3785:Kcnd3 UTSW 3 105668225 missense possibly damaging 0.79
R3810:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3811:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3815:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3816:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3819:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3877:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3879:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3899:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4300:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4367:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4370:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4491:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4549:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4550:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4569:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4571:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4593:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4594:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4595:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4624:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4625:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4627:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4630:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4631:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4632:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4799:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4822:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R5021:Kcnd3 UTSW 3 105658754 missense probably damaging 1.00
R5056:Kcnd3 UTSW 3 105666928 intron probably benign
R5849:Kcnd3 UTSW 3 105458795 utr 5 prime probably benign
R7198:Kcnd3 UTSW 3 105459540 missense probably damaging 1.00
R7224:Kcnd3 UTSW 3 105669084 missense probably damaging 0.98
R7532:Kcnd3 UTSW 3 105668210 missense probably damaging 1.00
R7578:Kcnd3 UTSW 3 105459617 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGCGGCTCATGGATGACAATGAC -3'
(R):5'- AAGAAAGCCCAGTTCTGAGGCAC -3'

Sequencing Primer
(F):5'- GTCTCGGTCATCACCAATGTG -3'
(R):5'- CACAGCTCTTCAGGGTGTAG -3'
Posted On2013-05-23