Incidental Mutation 'R0483:Phc2'
ID42104
Institutional Source Beutler Lab
Gene Symbol Phc2
Ensembl Gene ENSMUSG00000028796
Gene Namepolyhomeotic 2
SynonymsEdr2, D4Ertd810e, Mph2, D130050K19Rik
MMRRC Submission 038683-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0483 (G1)
Quality Score157
Status Validated
Chromosome4
Chromosomal Location128654702-128752881 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 128723307 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030588] [ENSMUST00000106079] [ENSMUST00000106080] [ENSMUST00000120946] [ENSMUST00000133439] [ENSMUST00000134421] [ENSMUST00000138445] [ENSMUST00000143632] [ENSMUST00000147572]
Predicted Effect probably benign
Transcript: ENSMUST00000030588
SMART Domains Protein: ENSMUSP00000030588
Gene: ENSMUSG00000028796

DomainStartEndE-ValueType
low complexity region 15 41 N/A INTRINSIC
low complexity region 74 119 N/A INTRINSIC
low complexity region 126 152 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 257 269 N/A INTRINSIC
low complexity region 343 367 N/A INTRINSIC
low complexity region 487 499 N/A INTRINSIC
low complexity region 529 543 N/A INTRINSIC
Pfam:PHC2_SAM_assoc 662 781 2.6e-55 PFAM
SAM 783 850 8.53e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106079
SMART Domains Protein: ENSMUSP00000101689
Gene: ENSMUSG00000028796

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:2L8E|A 105 135 1e-6 PDB
low complexity region 216 228 N/A INTRINSIC
SAM 256 323 8.53e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106080
SMART Domains Protein: ENSMUSP00000101690
Gene: ENSMUSG00000028796

DomainStartEndE-ValueType
low complexity region 15 41 N/A INTRINSIC
low complexity region 74 119 N/A INTRINSIC
low complexity region 126 152 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 257 269 N/A INTRINSIC
low complexity region 343 367 N/A INTRINSIC
low complexity region 487 499 N/A INTRINSIC
low complexity region 529 543 N/A INTRINSIC
PDB:2L8E|A 632 662 4e-7 PDB
low complexity region 743 755 N/A INTRINSIC
SAM 783 850 8.53e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120946
Predicted Effect probably benign
Transcript: ENSMUST00000133439
SMART Domains Protein: ENSMUSP00000117163
Gene: ENSMUSG00000028796

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134421
SMART Domains Protein: ENSMUSP00000123307
Gene: ENSMUSG00000028796

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:2L8E|A 105 135 6e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000138445
Predicted Effect probably benign
Transcript: ENSMUST00000143632
Predicted Effect probably benign
Transcript: ENSMUST00000147572
SMART Domains Protein: ENSMUSP00000118298
Gene: ENSMUSG00000028796

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:2L8E|A 105 135 8e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155653
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In Drosophila melanogaster, the 'Polycomb' group (PcG) of genes are part of a cellular memory system that is responsible for the stable inheritance of gene activity. PcG proteins form a large multimeric, chromatin-associated protein complex. The protein encoded by this gene has homology to the Drosophila PcG protein 'polyhomeotic' (Ph) and is known to heterodimerize with EDR1 and colocalize with BMI1 in interphase nuclei of human cells. The specific function in human cells has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele have normal skulls but exhibit posterior homeotic transformations of the axial skeleton. Cultured mouse embryonic fibroblasts show defects in proliferation and premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik G A 10: 83,759,638 probably benign Het
1700048O20Rik A T 9: 121,940,703 noncoding transcript Het
2900011O08Rik T C 16: 14,095,939 *113R probably null Het
AA986860 A G 1: 130,743,825 R595G probably damaging Het
Acrbp C A 6: 125,054,796 F353L possibly damaging Het
Adamts20 T A 15: 94,353,571 Q445L probably benign Het
Adgrg5 A G 8: 94,933,508 D26G possibly damaging Het
Atad2b A T 12: 4,945,035 probably benign Het
Atg2a G T 19: 6,256,601 G1439C probably damaging Het
Atg2a G T 19: 6,256,602 G1439V probably benign Het
B3galt1 G A 2: 68,118,588 V216I probably benign Het
C2cd2 A G 16: 97,859,588 probably benign Het
Cacna2d1 G A 5: 16,359,027 V884M probably damaging Het
Cers5 C A 15: 99,745,914 C22F probably damaging Het
Ces1d C A 8: 93,197,679 C14F probably benign Het
Cntn3 G T 6: 102,203,966 P756Q probably damaging Het
Col4a1 T C 8: 11,236,423 probably benign Het
Col5a3 A G 9: 20,782,481 probably null Het
Cox5b G A 1: 36,692,555 probably null Het
Cwc27 C A 13: 104,811,216 probably null Het
Cyp27b1 A C 10: 127,050,157 M260L probably benign Het
D11Wsu47e C T 11: 113,689,195 T472I possibly damaging Het
Ddx19b A T 8: 111,008,678 N465K probably benign Het
Depdc1b T C 13: 108,373,848 V298A probably benign Het
Dnaaf1 A G 8: 119,590,666 I311M possibly damaging Het
Dnah17 T C 11: 118,047,124 N3372S probably benign Het
Dus4l G A 12: 31,641,657 T184I possibly damaging Het
Dzip3 T C 16: 48,947,713 K453E possibly damaging Het
Fhod3 C T 18: 24,709,616 T3M probably damaging Het
Galnt10 T C 11: 57,781,222 L446P probably damaging Het
Gfod1 T A 13: 43,200,536 D321V possibly damaging Het
Glt8d2 C A 10: 82,662,153 probably benign Het
Gm11115 A G 5: 88,154,089 M4T unknown Het
Gm11568 G A 11: 99,858,383 C138Y unknown Het
Gm9742 A G 13: 8,035,016 noncoding transcript Het
Gnrhr G T 5: 86,197,575 T84N probably damaging Het
Gpr176 C A 2: 118,279,723 G352W probably damaging Het
Habp2 T C 19: 56,316,432 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Inpp5j C G 11: 3,499,738 W681C probably damaging Het
Insl6 A G 19: 29,321,568 M148T probably benign Het
Itgb1 T G 8: 128,726,167 M771R possibly damaging Het
Kank1 G T 19: 25,425,993 probably benign Het
Kcnd3 T C 3: 105,459,626 Y271H probably damaging Het
Kcnq4 C A 4: 120,716,601 R221L probably damaging Het
Klk1b26 G A 7: 44,016,348 V195I probably benign Het
Lactb A C 9: 66,970,863 V228G possibly damaging Het
Ldb3 T C 14: 34,536,584 D649G probably damaging Het
Lilra6 T A 7: 3,913,139 R240S probably benign Het
Lrp2 A G 2: 69,507,801 Y1212H probably damaging Het
Mapk8ip1 A T 2: 92,385,976 probably null Het
Mctp1 C T 13: 76,827,727 L483F probably damaging Het
Mmp16 T C 4: 18,115,878 probably benign Het
Mphosph9 A T 5: 124,306,970 L360* probably null Het
Myh4 A G 11: 67,252,297 E1017G probably damaging Het
Nell1 A T 7: 50,230,180 M307L probably benign Het
Olfr1028 A G 2: 85,951,243 Y60C probably damaging Het
Olfr1082 A G 2: 86,594,408 V140A probably benign Het
Olfr119 C T 17: 37,701,297 A209V probably benign Het
Olfr959 A C 9: 39,572,843 C139G probably damaging Het
Pp2d1 C A 17: 53,507,971 C575F probably benign Het
Ptpra T A 2: 130,539,685 N364K probably damaging Het
R3hcc1l A G 19: 42,562,556 probably benign Het
Rims1 A G 1: 22,468,182 probably benign Het
Shank3 G A 15: 89,543,239 probably benign Het
Sit1 T A 4: 43,482,991 Q86L possibly damaging Het
Skint4 C A 4: 112,117,939 probably benign Het
Skint8 G T 4: 111,938,823 probably benign Het
Smim13 T C 13: 41,272,710 I74T probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Speg A G 1: 75,385,032 E230G possibly damaging Het
Srpr A G 9: 35,215,995 T614A possibly damaging Het
Synpo2 T C 3: 123,114,332 D445G probably damaging Het
Tas2r102 A T 6: 132,762,365 I79F probably damaging Het
Thegl A G 5: 77,037,357 probably benign Het
Tmc4 A G 7: 3,667,610 L494P probably damaging Het
Togaram1 G T 12: 65,007,031 V1412F probably damaging Het
Topors T C 4: 40,261,952 D444G probably damaging Het
Trappc8 T A 18: 20,845,601 I813F possibly damaging Het
Trim26 T C 17: 36,852,706 probably benign Het
Unc13a T C 8: 71,644,913 D1171G probably damaging Het
Usp7 A G 16: 8,699,262 V245A probably damaging Het
Vmn1r38 T A 6: 66,776,995 T46S probably benign Het
Vmn2r76 T C 7: 86,225,751 T673A probably damaging Het
Zcchc14 T A 8: 121,628,649 probably benign Het
Zfp451 T A 1: 33,770,910 probably benign Het
Other mutations in Phc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Phc2 APN 4 128745844 missense probably damaging 1.00
IGL01470:Phc2 APN 4 128723110 missense probably benign 0.00
IGL02171:Phc2 APN 4 128711065 missense probably damaging 1.00
IGL02884:Phc2 APN 4 128708016 missense probably damaging 1.00
I1329:Phc2 UTSW 4 128711113 missense probably damaging 0.98
PIT4696001:Phc2 UTSW 4 128705202 missense probably damaging 1.00
R0625:Phc2 UTSW 4 128723710 missense possibly damaging 0.80
R1392:Phc2 UTSW 4 128745087 missense possibly damaging 0.63
R1392:Phc2 UTSW 4 128745087 missense possibly damaging 0.63
R1429:Phc2 UTSW 4 128743555 missense probably damaging 1.00
R1701:Phc2 UTSW 4 128751607 missense probably damaging 1.00
R1820:Phc2 UTSW 4 128743543 missense probably damaging 0.99
R2011:Phc2 UTSW 4 128723585 missense probably benign 0.27
R2063:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2064:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2065:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2066:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2067:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2152:Phc2 UTSW 4 128745066 makesense probably null
R2375:Phc2 UTSW 4 128723025 missense probably benign
R2430:Phc2 UTSW 4 128707983 missense probably damaging 1.00
R3910:Phc2 UTSW 4 128743558 critical splice donor site probably null
R3911:Phc2 UTSW 4 128743558 critical splice donor site probably null
R3941:Phc2 UTSW 4 128747244 critical splice donor site probably null
R4108:Phc2 UTSW 4 128707983 missense probably damaging 1.00
R4585:Phc2 UTSW 4 128743510 missense probably damaging 1.00
R4731:Phc2 UTSW 4 128707971 missense probably damaging 1.00
R4801:Phc2 UTSW 4 128751598 missense probably damaging 1.00
R4802:Phc2 UTSW 4 128751598 missense probably damaging 1.00
R4948:Phc2 UTSW 4 128723115 missense probably benign 0.00
R5498:Phc2 UTSW 4 128708994 missense probably benign 0.37
R5712:Phc2 UTSW 4 128745095 missense probably damaging 1.00
R5742:Phc2 UTSW 4 128745868 missense probably damaging 1.00
R6272:Phc2 UTSW 4 128709647 missense probably damaging 1.00
R6298:Phc2 UTSW 4 128748189 missense possibly damaging 0.91
R6348:Phc2 UTSW 4 128705151 missense probably benign 0.00
R6630:Phc2 UTSW 4 128723630 missense probably damaging 0.97
R6925:Phc2 UTSW 4 128748134 missense probably damaging 1.00
R7067:Phc2 UTSW 4 128747141 missense probably benign 0.02
R7396:Phc2 UTSW 4 128748161 missense probably benign 0.21
R7585:Phc2 UTSW 4 128711139 missense probably benign 0.35
R7590:Phc2 UTSW 4 128748027 missense probably damaging 1.00
R7723:Phc2 UTSW 4 128723089 missense probably benign 0.33
X0012:Phc2 UTSW 4 128709052 missense probably damaging 0.99
X0017:Phc2 UTSW 4 128723272 missense probably damaging 0.99
X0023:Phc2 UTSW 4 128708043 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGTTTGTGGCCCAACAGCAACC -3'
(R):5'- CTCGGGCAAAGATGCAAAGATTCAG -3'

Sequencing Primer
(F):5'- CTCTAGGCTCAGTGACACAG -3'
(R):5'- GTCATCTCTAAGTCTGGGAGCAC -3'
Posted On2013-05-23