Mutagenetix > Incidental Mutation

Incidental Mutation 'R0483:Atg2a'

42164

Institutional Source

Beutler Lab

Gene Symbol

Atg2a

Ensembl Gene

ENSMUSG00000024773

Gene Name

autophagy related 2A

Synonyms

MMRRC Submission

038683-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.452) question?

Stock #

R0483 (G1)

Quality Score

176

Status

Validated

Chromosome

Chromosomal Location

6241668-6262335 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 6256601 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 1439 (G1439C)

Ref Sequence

ENSEMBL: ENSMUSP00000046412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045351]

AlphaFold

Q6P4T0

Predicted Effect

probably damaging
Transcript: ENSMUST00000045351
AA Change: G1439C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000046412
Gene: ENSMUSG00000024773
AA Change: G1439C

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	14	131	7.6e-20	PFAM
low complexity region	138	154	N/A	INTRINSIC
low complexity region	285	301	N/A	INTRINSIC
low complexity region	501	512	N/A	INTRINSIC
low complexity region	852	863	N/A	INTRINSIC
low complexity region	1069	1081	N/A	INTRINSIC
low complexity region	1429	1446	N/A	INTRINSIC
low complexity region	1761	1773	N/A	INTRINSIC
Pfam:ATG_C	1814	1908	2.2e-31	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135018

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143053

Predicted Effect

unknown
Transcript: ENSMUST00000145600
AA Change: G1242C

SMART Domains

Protein: ENSMUSP00000114998
Gene: ENSMUSG00000024773
AA Change: G1242C

Domain	Start	End	E-Value	Type
low complexity region	87	103	N/A	INTRINSIC
low complexity region	303	314	N/A	INTRINSIC
low complexity region	654	665	N/A	INTRINSIC
low complexity region	871	883	N/A	INTRINSIC
low complexity region	1233	1250	N/A	INTRINSIC
low complexity region	1565	1577	N/A	INTRINSIC
Pfam:ATG_C	1618	1712	3.6e-32	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151079

Meta Mutation Damage Score

0.1001

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

99% (89/90)

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1500009L16Rik	G	A	10: 83,759,638		probably benign	Het
1700048O20Rik	A	T	9: 121,940,703		noncoding transcript	Het
2900011O08Rik	T	C	16: 14,095,939	*113R	probably null	Het
AA986860	A	G	1: 130,743,825	R595G	probably damaging	Het
Acrbp	C	A	6: 125,054,796	F353L	possibly damaging	Het
Adamts20	T	A	15: 94,353,571	Q445L	probably benign	Het
Adgrg5	A	G	8: 94,933,508	D26G	possibly damaging	Het
Atad2b	A	T	12: 4,945,035		probably benign	Het
B3galt1	G	A	2: 68,118,588	V216I	probably benign	Het
C2cd2	A	G	16: 97,859,588		probably benign	Het
Cacna2d1	G	A	5: 16,359,027	V884M	probably damaging	Het
Cers5	C	A	15: 99,745,914	C22F	probably damaging	Het
Ces1d	C	A	8: 93,197,679	C14F	probably benign	Het
Cntn3	G	T	6: 102,203,966	P756Q	probably damaging	Het
Col4a1	T	C	8: 11,236,423		probably benign	Het
Col5a3	A	G	9: 20,782,481		probably null	Het
Cox5b	G	A	1: 36,692,555		probably null	Het
Cwc27	C	A	13: 104,811,216		probably null	Het
Cyp27b1	A	C	10: 127,050,157	M260L	probably benign	Het
D11Wsu47e	C	T	11: 113,689,195	T472I	possibly damaging	Het
Ddx19b	A	T	8: 111,008,678	N465K	probably benign	Het
Depdc1b	T	C	13: 108,373,848	V298A	probably benign	Het
Dnaaf1	A	G	8: 119,590,666	I311M	possibly damaging	Het
Dnah17	T	C	11: 118,047,124	N3372S	probably benign	Het
Dus4l	G	A	12: 31,641,657	T184I	possibly damaging	Het
Dzip3	T	C	16: 48,947,713	K453E	possibly damaging	Het
Fhod3	C	T	18: 24,709,616	T3M	probably damaging	Het
Galnt10	T	C	11: 57,781,222	L446P	probably damaging	Het
Gfod1	T	A	13: 43,200,536	D321V	possibly damaging	Het
Glt8d2	C	A	10: 82,662,153		probably benign	Het
Gm11115	A	G	5: 88,154,089	M4T	unknown	Het
Gm11568	G	A	11: 99,858,383	C138Y	unknown	Het
Gm9742	A	G	13: 8,035,016		noncoding transcript	Het
Gnrhr	G	T	5: 86,197,575	T84N	probably damaging	Het
Gpr176	C	A	2: 118,279,723	G352W	probably damaging	Het
Habp2	T	C	19: 56,316,432		probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Inpp5j	C	G	11: 3,499,738	W681C	probably damaging	Het
Insl6	A	G	19: 29,321,568	M148T	probably benign	Het
Itgb1	T	G	8: 128,726,167	M771R	possibly damaging	Het
Kank1	G	T	19: 25,425,993		probably benign	Het
Kcnd3	T	C	3: 105,459,626	Y271H	probably damaging	Het
Kcnq4	C	A	4: 120,716,601	R221L	probably damaging	Het
Klk1b26	G	A	7: 44,016,348	V195I	probably benign	Het
Lactb	A	C	9: 66,970,863	V228G	possibly damaging	Het
Ldb3	T	C	14: 34,536,584	D649G	probably damaging	Het
Lilra6	T	A	7: 3,913,139	R240S	probably benign	Het
Lrp2	A	G	2: 69,507,801	Y1212H	probably damaging	Het
Mapk8ip1	A	T	2: 92,385,976		probably null	Het
Mctp1	C	T	13: 76,827,727	L483F	probably damaging	Het
Mmp16	T	C	4: 18,115,878		probably benign	Het
Mphosph9	A	T	5: 124,306,970	L360*	probably null	Het
Myh4	A	G	11: 67,252,297	E1017G	probably damaging	Het
Nell1	A	T	7: 50,230,180	M307L	probably benign	Het
Olfr1028	A	G	2: 85,951,243	Y60C	probably damaging	Het
Olfr1082	A	G	2: 86,594,408	V140A	probably benign	Het
Olfr119	C	T	17: 37,701,297	A209V	probably benign	Het
Olfr959	A	C	9: 39,572,843	C139G	probably damaging	Het
Phc2	A	G	4: 128,723,307		probably benign	Het
Pp2d1	C	A	17: 53,507,971	C575F	probably benign	Het
Ptpra	T	A	2: 130,539,685	N364K	probably damaging	Het
R3hcc1l	A	G	19: 42,562,556		probably benign	Het
Rims1	A	G	1: 22,468,182		probably benign	Het
Shank3	G	A	15: 89,543,239		probably benign	Het
Sit1	T	A	4: 43,482,991	Q86L	possibly damaging	Het
Skint4	C	A	4: 112,117,939		probably benign	Het
Skint8	G	T	4: 111,938,823		probably benign	Het
Smim13	T	C	13: 41,272,710	I74T	probably benign	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Speg	A	G	1: 75,385,032	E230G	possibly damaging	Het
Srpr	A	G	9: 35,215,995	T614A	possibly damaging	Het
Synpo2	T	C	3: 123,114,332	D445G	probably damaging	Het
Tas2r102	A	T	6: 132,762,365	I79F	probably damaging	Het
Thegl	A	G	5: 77,037,357		probably benign	Het
Tmc4	A	G	7: 3,667,610	L494P	probably damaging	Het
Togaram1	G	T	12: 65,007,031	V1412F	probably damaging	Het
Topors	T	C	4: 40,261,952	D444G	probably damaging	Het
Trappc8	T	A	18: 20,845,601	I813F	possibly damaging	Het
Trim26	T	C	17: 36,852,706		probably benign	Het
Unc13a	T	C	8: 71,644,913	D1171G	probably damaging	Het
Usp7	A	G	16: 8,699,262	V245A	probably damaging	Het
Vmn1r38	T	A	6: 66,776,995	T46S	probably benign	Het
Vmn2r76	T	C	7: 86,225,751	T673A	probably damaging	Het
Zcchc14	T	A	8: 121,628,649		probably benign	Het
Zfp451	T	A	1: 33,770,910		probably benign	Het

Other mutations in Atg2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Atg2a	APN	19	6254599	missense	probably damaging	1.00
IGL01612:Atg2a	APN	19	6252484	missense	probably benign	0.03
IGL02105:Atg2a	APN	19	6250403	splice site	probably benign
IGL02151:Atg2a	APN	19	6255757	missense	possibly damaging	0.95
IGL02228:Atg2a	APN	19	6246800	missense	probably benign	0.29
IGL02329:Atg2a	APN	19	6249929	critical splice donor site	probably null
IGL02408:Atg2a	APN	19	6241828	nonsense	probably null
IGL02538:Atg2a	APN	19	6257628	missense	probably benign
IGL02830:Atg2a	APN	19	6247681	missense	probably benign	0.04
IGL03349:Atg2a	APN	19	6258024	missense	possibly damaging	0.77
PIT4515001:Atg2a	UTSW	19	6253585	missense	probably damaging	1.00
R0099:Atg2a	UTSW	19	6252789	missense	probably damaging	0.97
R0212:Atg2a	UTSW	19	6246554	missense	probably damaging	1.00
R0365:Atg2a	UTSW	19	6247683	missense	possibly damaging	0.51
R0398:Atg2a	UTSW	19	6246578	missense	probably damaging	1.00
R0483:Atg2a	UTSW	19	6256602	missense	probably benign	0.01
R0494:Atg2a	UTSW	19	6253377	missense	probably damaging	1.00
R0511:Atg2a	UTSW	19	6252539	missense	possibly damaging	0.89
R0590:Atg2a	UTSW	19	6245007	unclassified	probably benign
R0592:Atg2a	UTSW	19	6245007	unclassified	probably benign
R0593:Atg2a	UTSW	19	6245007	unclassified	probably benign
R0630:Atg2a	UTSW	19	6244517	missense	probably damaging	0.99
R1306:Atg2a	UTSW	19	6253021	missense	probably benign	0.31
R1437:Atg2a	UTSW	19	6250616	missense	probably damaging	1.00
R1539:Atg2a	UTSW	19	6246771	splice site	probably null
R1774:Atg2a	UTSW	19	6250598	missense	probably benign	0.01
R1781:Atg2a	UTSW	19	6256213	missense	probably damaging	0.96
R1854:Atg2a	UTSW	19	6252431	missense	probably benign	0.11
R1884:Atg2a	UTSW	19	6254384	missense	probably damaging	1.00
R1899:Atg2a	UTSW	19	6245067	missense	probably damaging	1.00
R1935:Atg2a	UTSW	19	6252536	missense	probably damaging	1.00
R2020:Atg2a	UTSW	19	6250269	critical splice donor site	probably null
R2071:Atg2a	UTSW	19	6257458	missense	probably benign	0.00
R2513:Atg2a	UTSW	19	6258046	critical splice donor site	probably null
R3808:Atg2a	UTSW	19	6252816	missense	possibly damaging	0.71
R4065:Atg2a	UTSW	19	6258366	missense	probably damaging	1.00
R4109:Atg2a	UTSW	19	6258374	missense	possibly damaging	0.95
R4352:Atg2a	UTSW	19	6257457	missense	probably benign	0.04
R4440:Atg2a	UTSW	19	6255829	critical splice donor site	probably null
R4472:Atg2a	UTSW	19	6258955	missense	probably damaging	0.98
R4669:Atg2a	UTSW	19	6258987	critical splice donor site	probably null
R4878:Atg2a	UTSW	19	6250244	missense	probably damaging	1.00
R4926:Atg2a	UTSW	19	6257533	missense	probably damaging	0.96
R5237:Atg2a	UTSW	19	6246814	missense	probably benign
R5350:Atg2a	UTSW	19	6251338	missense	probably damaging	0.99
R5507:Atg2a	UTSW	19	6245070	missense	possibly damaging	0.94
R5732:Atg2a	UTSW	19	6257460	missense	probably damaging	1.00
R5784:Atg2a	UTSW	19	6261505	missense	probably damaging	1.00
R5960:Atg2a	UTSW	19	6254360	missense	probably damaging	1.00
R5985:Atg2a	UTSW	19	6254637	missense	probably damaging	1.00
R6175:Atg2a	UTSW	19	6241729	unclassified	probably benign
R6572:Atg2a	UTSW	19	6254665	missense	probably damaging	0.98
R6878:Atg2a	UTSW	19	6250178	missense	probably damaging	0.99
R6879:Atg2a	UTSW	19	6251852	missense	possibly damaging	0.70
R6983:Atg2a	UTSW	19	6260040	missense	probably damaging	0.99
R7024:Atg2a	UTSW	19	6250219	missense	possibly damaging	0.88
R7217:Atg2a	UTSW	19	6253441	critical splice donor site	probably null
R7384:Atg2a	UTSW	19	6261677	missense	probably damaging	1.00
R7387:Atg2a	UTSW	19	6255168	missense	possibly damaging	0.79
R7425:Atg2a	UTSW	19	6255652	missense	probably benign	0.02
R7512:Atg2a	UTSW	19	6260076	missense	probably damaging	1.00
R7658:Atg2a	UTSW	19	6251263	missense	probably damaging	1.00
R7893:Atg2a	UTSW	19	6251296	missense	probably damaging	1.00
R8062:Atg2a	UTSW	19	6252579	critical splice donor site	probably null
R8258:Atg2a	UTSW	19	6249829	missense	probably damaging	0.98
R8259:Atg2a	UTSW	19	6249829	missense	probably damaging	0.98
R8350:Atg2a	UTSW	19	6246811	missense	probably benign	0.03
R8412:Atg2a	UTSW	19	6244524	missense	probably damaging	1.00
R8450:Atg2a	UTSW	19	6246811	missense	probably benign	0.03
R8474:Atg2a	UTSW	19	6251403	critical splice donor site	probably null
R8501:Atg2a	UTSW	19	6254390	missense	probably damaging	1.00
R8738:Atg2a	UTSW	19	6256644	missense	probably benign	0.00
R8786:Atg2a	UTSW	19	6244430	missense	probably damaging	1.00
R8810:Atg2a	UTSW	19	6250621	missense	probably benign	0.01
R8898:Atg2a	UTSW	19	6256691	splice site	probably benign
R9016:Atg2a	UTSW	19	6250081	missense	probably damaging	1.00
R9111:Atg2a	UTSW	19	6261504	missense	probably damaging	1.00
R9177:Atg2a	UTSW	19	6241875	missense	probably damaging	1.00
R9184:Atg2a	UTSW	19	6241857	missense	probably damaging	1.00
R9268:Atg2a	UTSW	19	6241875	missense	probably damaging	1.00
R9496:Atg2a	UTSW	19	6259992	missense	possibly damaging	0.63
R9570:Atg2a	UTSW	19	6255719	missense	probably benign	0.03
R9642:Atg2a	UTSW	19	6250168	nonsense	probably null
X0065:Atg2a	UTSW	19	6258196	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TAGAGACTTTGGCCTTCACCCCAC -3'
(R):5'- TGGAATCTGTCCTCAGCATACCCC -3'

Sequencing Primer
(F):5'- CCCACTTACAGGTTAGAGGC -3'
(R):5'- GCATACCCCACTGCCCG -3'

Posted On

2013-05-23