Mutagenetix > Incidental Mutations

Incidental Mutation 'R0485:Scn1a'

42177

Institutional Source

Beutler Lab

Gene Symbol

Scn1a

Ensembl Gene

ENSMUSG00000064329

Gene Name

sodium channel, voltage-gated, type I, alpha

Synonyms

Nav1.1

MMRRC Submission

038684-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0485 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66270778-66440840 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 66273925 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 1664 (M1664V)

Ref Sequence

ENSEMBL: ENSMUSP00000107985 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077489] [ENSMUST00000094951] [ENSMUST00000112366] [ENSMUST00000112371] [ENSMUST00000156865]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077489
AA Change: M1653V

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000076697
Gene: ENSMUSG00000064329
AA Change: M1653V

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	156	422	5.4e-77	PFAM
low complexity region	431	466	N/A	INTRINSIC
Pfam:DUF3451	484	708	5.5e-73	PFAM
Pfam:Ion_trans	791	980	6.8e-47	PFAM
Pfam:Na_trans_assoc	995	1217	1.2e-74	PFAM
Pfam:Ion_trans	1243	1471	1.1e-56	PFAM
PDB:1BYY\|A	1473	1525	4e-31	PDB
Pfam:Ion_trans	1564	1774	1.1e-51	PFAM
Pfam:PKD_channel	1623	1781	3.9e-7	PFAM
low complexity region	1826	1838	N/A	INTRINSIC
IQ	1903	1925	1.65e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000094951
AA Change: M1636V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000092558
Gene: ENSMUSG00000064329
AA Change: M1636V

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	156	422	5.3e-77	PFAM
low complexity region	431	466	N/A	INTRINSIC
Pfam:DUF3451	484	691	2e-62	PFAM
Pfam:Ion_trans	774	963	6.7e-47	PFAM
Pfam:Na_trans_assoc	978	1200	1.2e-74	PFAM
Pfam:Ion_trans	1226	1454	1e-56	PFAM
PDB:1BYY\|A	1456	1508	4e-31	PDB
Pfam:Ion_trans	1547	1757	1.1e-51	PFAM
Pfam:PKD_channel	1606	1764	3.8e-7	PFAM
low complexity region	1809	1821	N/A	INTRINSIC
IQ	1886	1908	1.65e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112366
AA Change: M1664V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000107985
Gene: ENSMUSG00000064329
AA Change: M1664V

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	127	434	2.8e-82	PFAM
Pfam:Na_trans_cytopl	502	718	2e-91	PFAM
Pfam:Ion_trans	767	1002	6.5e-57	PFAM
Pfam:Na_trans_assoc	1006	1213	1.2e-60	PFAM
Pfam:Ion_trans	1217	1493	3.3e-67	PFAM
Pfam:Ion_trans	1540	1797	6.3e-56	PFAM
Pfam:PKD_channel	1637	1791	1.1e-6	PFAM
low complexity region	1837	1849	N/A	INTRINSIC
IQ	1914	1936	1.65e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112371
AA Change: M1653V

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107990
Gene: ENSMUSG00000064329
AA Change: M1653V

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	156	422	5.4e-77	PFAM
low complexity region	431	466	N/A	INTRINSIC
Pfam:DUF3451	484	708	5.5e-73	PFAM
Pfam:Ion_trans	791	980	6.8e-47	PFAM
Pfam:Na_trans_assoc	995	1217	1.2e-74	PFAM
Pfam:Ion_trans	1243	1471	1.1e-56	PFAM
PDB:1BYY\|A	1473	1525	4e-31	PDB
Pfam:Ion_trans	1564	1774	1.1e-51	PFAM
Pfam:PKD_channel	1623	1781	3.9e-7	PFAM
low complexity region	1826	1838	N/A	INTRINSIC
IQ	1903	1925	1.65e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000156865

SMART Domains

Protein: ENSMUSP00000144633
Gene: ENSMUSG00000064329

Domain	Start	End	E-Value	Type
Pfam:Na_trans_assoc	1	182	2.2e-44	PFAM
Pfam:Ion_trans	186	462	1.3e-66	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000200839

Meta Mutation Damage Score

0.6719

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.4%

Validation Efficiency

100% (95/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice show postnatal lethality, seizures and behavioral deficits whereas heterozygotes die prematurely with seizures and abnormal electrophysiology. In addition, knock-in mice exhibit increased susceptibility to febrile and flurothyl-induced seizures, and reduced inhibitory signaling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700037C18Rik	A	G	16: 3,907,647	V5A	probably damaging	Het
Abi3bp	A	G	16: 56,604,012		probably null	Het
Acot11	G	A	4: 106,762,027	R184C	probably damaging	Het
Adgre5	A	T	8: 83,731,998	I133N	probably damaging	Het
Afap1	A	T	5: 35,951,003	Q231L	probably damaging	Het
Alg12	T	C	15: 88,811,427	T289A	probably benign	Het
Ank3	T	A	10: 69,882,544	S542T	possibly damaging	Het
Ankmy2	G	A	12: 36,182,390	R138Q	possibly damaging	Het
Ascc2	C	T	11: 4,672,302	A456V	probably benign	Het
Atg4c	G	A	4: 99,224,482	V289I	probably benign	Het
Bbs7	A	T	3: 36,602,873	Y269N	probably damaging	Het
Bcas3	T	A	11: 85,495,850	D370E	probably damaging	Het
Bicc1	T	G	10: 70,925,315	E955A	probably damaging	Het
Bok	T	C	1: 93,689,277	F115S	probably damaging	Het
Caap1	A	T	4: 94,550,521		probably null	Het
Cacna2d3	T	A	14: 29,534,519	M95L	possibly damaging	Het
Calcrl	T	A	2: 84,370,091	D115V	probably benign	Het
Car7	A	T	8: 104,543,538	M57L	probably benign	Het
Casq1	G	T	1: 172,210,390		probably benign	Het
Cep290	A	T	10: 100,549,344	D1894V	possibly damaging	Het
Clec4a2	T	A	6: 123,123,629	N14K	probably damaging	Het
Col16a1	G	T	4: 130,090,497		probably benign	Het
Col5a1	T	C	2: 27,990,097		probably benign	Het
Col5a2	A	T	1: 45,378,482	I1311N	probably damaging	Het
Col5a3	T	C	9: 20,782,708	T1050A	probably damaging	Het
Colgalt2	A	T	1: 152,484,871	I220F	probably damaging	Het
Cpb1	A	T	3: 20,275,628	V8E	unknown	Het
Dchs1	C	T	7: 105,772,727	R162H	probably benign	Het
Dhx37	A	G	5: 125,422,231	Y638H	probably benign	Het
Dhx40	T	G	11: 86,771,262		probably benign	Het
Ehd2	T	A	7: 15,952,076	Q357L	probably benign	Het
Ewsr1	T	C	11: 5,070,737		probably benign	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Gid8	T	A	2: 180,713,211	Y3*	probably null	Het
Gm10212	A	C	19: 11,570,810		noncoding transcript	Het
Gm4763	C	A	7: 24,722,745	C193F	possibly damaging	Het
Gm597	G	T	1: 28,778,142	Q270K	probably damaging	Het
Gm960	A	T	19: 4,658,414	I350N	probably damaging	Het
Grin3b	T	A	10: 79,974,056	N465K	possibly damaging	Het
Hist1h1d	A	T	13: 23,555,750	K221*	probably null	Het
Htr4	A	T	18: 62,428,154	N162I	probably damaging	Het
Itga3	T	C	11: 95,061,970	D325G	probably benign	Het
Itpr3	T	G	17: 27,111,929	V1737G	probably damaging	Het
Kcnab2	C	T	4: 152,394,982	V251I	probably benign	Het
Kcnn2	A	T	18: 45,560,148	I264L	probably benign	Het
Klhl41	T	C	2: 69,671,256	Y354H	probably damaging	Het
Klra6	T	C	6: 130,023,638	I68V	probably benign	Het
Letm2	G	T	8: 25,592,558	P178Q	probably damaging	Het
Lrmp	T	C	6: 145,165,212	C248R	probably damaging	Het
Mbtps1	A	T	8: 119,522,601		probably benign	Het
Mecom	C	T	3: 29,980,972		probably benign	Het
Mrps5	T	A	2: 127,591,825	S45T	possibly damaging	Het
Msra	T	A	14: 64,440,761	I29F	possibly damaging	Het
Mup5	T	C	4: 61,832,992		probably null	Het
Myo1a	T	C	10: 127,719,242		probably benign	Het
Myrip	C	A	9: 120,441,377	N564K	probably benign	Het
Naa20	T	A	2: 145,915,672	D148E	probably damaging	Het
Naga	T	G	15: 82,336,755		probably benign	Het
Npc1	A	G	18: 12,213,446	V231A	probably benign	Het
Nphs1	T	C	7: 30,467,515	F716L	probably benign	Het
Olfr284	T	C	15: 98,340,929	H20R	probably benign	Het
Parn	G	C	16: 13,654,435		probably benign	Het
Polk	A	T	13: 96,483,764	C664S	probably benign	Het
Prkar2b	A	G	12: 31,976,035		probably benign	Het
Prkdc	A	G	16: 15,833,740	E3747G	probably damaging	Het
Prmt5	A	T	14: 54,511,255	M362K	probably damaging	Het
Prob1	T	C	18: 35,653,825	T459A	possibly damaging	Het
Rttn	C	T	18: 89,090,419		probably benign	Het
Sez6	T	A	11: 77,953,813	L154H	probably damaging	Het
Sh3tc1	A	G	5: 35,702,012		probably benign	Het
Shkbp1	C	T	7: 27,348,581	G334D	probably damaging	Het
Slc8a1	A	T	17: 81,647,993	F539I	probably damaging	Het
Sptan1	T	C	2: 30,013,848		probably benign	Het
Ssc5d	C	T	7: 4,937,471	T861M	probably damaging	Het
Tbx5	A	T	5: 119,883,458	M510L	probably benign	Het
Tdp1	A	G	12: 99,909,842	T351A	probably benign	Het
Tmc8	T	A	11: 117,792,078		probably benign	Het
Tmco5	T	A	2: 116,890,107	D205E	probably benign	Het
Tmprss2	T	C	16: 97,571,994		probably benign	Het
Tph1	T	A	7: 46,650,024	K364N	probably benign	Het
Trim24	T	C	6: 37,957,066	L648P	probably damaging	Het
Trmt6	C	A	2: 132,809,030		probably benign	Het
Ube2i	A	T	17: 25,269,285		probably benign	Het
Vcan	A	C	13: 89,704,660	L727R	possibly damaging	Het
Vmn2r28	T	C	7: 5,488,690	Y186C	probably damaging	Het
Wars	C	A	12: 108,875,157	D232Y	probably damaging	Het
Xrcc5	T	C	1: 72,338,945		probably benign	Het
Zbtb24	T	A	10: 41,464,536	S543T	probably damaging	Het
Zfp91	A	G	19: 12,775,989		probably benign	Het

Other mutations in Scn1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:Scn1a	APN	2	66335531	critical splice acceptor site	probably null
IGL00650:Scn1a	APN	2	66280793	missense	probably damaging	1.00
IGL00658:Scn1a	APN	2	66286038	missense	probably damaging	1.00
IGL00823:Scn1a	APN	2	66324935	missense	probably benign	0.04
IGL00907:Scn1a	APN	2	66327797	missense	probably damaging	1.00
IGL01339:Scn1a	APN	2	66325960	missense	probably benign	0.09
IGL01401:Scn1a	APN	2	66289111	missense	probably damaging	1.00
IGL01503:Scn1a	APN	2	66322343	missense	probably damaging	1.00
IGL01575:Scn1a	APN	2	66273236	missense	probably damaging	1.00
IGL01598:Scn1a	APN	2	66302485	missense	possibly damaging	0.63
IGL01613:Scn1a	APN	2	66285937	missense	probably damaging	1.00
IGL01796:Scn1a	APN	2	66332301	splice site	probably benign
IGL02079:Scn1a	APN	2	66323360	missense	probably benign	0.14
IGL02171:Scn1a	APN	2	66273199	missense	probably damaging	1.00
IGL02335:Scn1a	APN	2	66277661	missense	possibly damaging	0.93
IGL02406:Scn1a	APN	2	66326036	missense	possibly damaging	0.88
IGL02436:Scn1a	APN	2	66351153	missense	probably benign	0.01
IGL02507:Scn1a	APN	2	66277813	missense	probably damaging	1.00
IGL02646:Scn1a	APN	2	66299618	splice site	probably null
IGL02729:Scn1a	APN	2	66299650	missense	probably damaging	1.00
IGL02740:Scn1a	APN	2	66324762	missense	probably damaging	1.00
IGL02740:Scn1a	APN	2	66318077	missense	probably benign	0.00
IGL02752:Scn1a	APN	2	66331412	missense	probably damaging	1.00
IGL02815:Scn1a	APN	2	66324858	missense	probably damaging	1.00
IGL03163:Scn1a	APN	2	66318074	missense	probably benign	0.00
IGL03229:Scn1a	APN	2	66299713	missense	probably damaging	1.00
IGL03286:Scn1a	APN	2	66277576	missense	probably damaging	0.99
IGL03393:Scn1a	APN	2	66318018	missense	probably benign	0.19
palsy	UTSW	2	66277656	intron	probably null
PIT4791001:Scn1a	UTSW	2	66273282	missense	probably benign	0.18
R0053:Scn1a	UTSW	2	66299775	missense	probably benign	0.05
R0053:Scn1a	UTSW	2	66299775	missense	probably benign	0.05
R0107:Scn1a	UTSW	2	66324633	missense	probably benign	0.07
R0141:Scn1a	UTSW	2	66289062	missense	probably damaging	1.00
R0517:Scn1a	UTSW	2	66302407	missense	possibly damaging	0.88
R0532:Scn1a	UTSW	2	66317823	missense	probably damaging	1.00
R0746:Scn1a	UTSW	2	66351126	missense	probably benign	0.25
R0755:Scn1a	UTSW	2	66321035	missense	probably damaging	1.00
R0830:Scn1a	UTSW	2	66299784	missense	probably damaging	1.00
R0846:Scn1a	UTSW	2	66324755	missense	probably benign	0.43
R0918:Scn1a	UTSW	2	66323307	splice site	probably null
R1055:Scn1a	UTSW	2	66337996	missense	probably benign	0.08
R1432:Scn1a	UTSW	2	66322429	missense	probably damaging	1.00
R1497:Scn1a	UTSW	2	66332287	missense	probably damaging	1.00
R1512:Scn1a	UTSW	2	66331285	missense	possibly damaging	0.82
R1525:Scn1a	UTSW	2	66319462	nonsense	probably null
R1567:Scn1a	UTSW	2	66273331	missense	probably damaging	1.00
R1702:Scn1a	UTSW	2	66318223	missense	probably damaging	1.00
R1744:Scn1a	UTSW	2	66322276	missense	probably benign	0.06
R1834:Scn1a	UTSW	2	66324616	missense	probably benign	0.04
R1834:Scn1a	UTSW	2	66324617	missense	probably benign	0.00
R1860:Scn1a	UTSW	2	66317982	missense	probably damaging	0.99
R1871:Scn1a	UTSW	2	66318025	missense	probably damaging	0.98
R1909:Scn1a	UTSW	2	66331352	missense	possibly damaging	0.58
R1967:Scn1a	UTSW	2	66328425	missense	probably damaging	1.00
R1976:Scn1a	UTSW	2	66331271	missense	probably benign	0.02
R2291:Scn1a	UTSW	2	66288968	missense	probably benign	0.44
R2302:Scn1a	UTSW	2	66277745	missense	probably damaging	1.00
R2367:Scn1a	UTSW	2	66327679	missense	probably damaging	1.00
R2418:Scn1a	UTSW	2	66273843	missense	probably damaging	0.98
R2517:Scn1a	UTSW	2	66273832	missense	probably damaging	1.00
R2568:Scn1a	UTSW	2	66273469	missense	probably damaging	1.00
R3083:Scn1a	UTSW	2	66299637	missense	probably damaging	1.00
R3903:Scn1a	UTSW	2	66318132	missense	probably benign	0.08
R3909:Scn1a	UTSW	2	66273988	missense	probably damaging	1.00
R3916:Scn1a	UTSW	2	66277613	missense	probably damaging	1.00
R3935:Scn1a	UTSW	2	66327776	missense	probably damaging	0.99
R3936:Scn1a	UTSW	2	66327776	missense	probably damaging	0.99
R4043:Scn1a	UTSW	2	66326036	missense	possibly damaging	0.60
R4429:Scn1a	UTSW	2	66350985	missense	possibly damaging	0.77
R4495:Scn1a	UTSW	2	66280802	critical splice acceptor site	probably null
R4662:Scn1a	UTSW	2	66350988	missense	probably benign	0.23
R4834:Scn1a	UTSW	2	66328522	nonsense	probably null
R4873:Scn1a	UTSW	2	66328476	missense	possibly damaging	0.92
R4875:Scn1a	UTSW	2	66328476	missense	possibly damaging	0.92
R5099:Scn1a	UTSW	2	66277801	missense	probably damaging	1.00
R5255:Scn1a	UTSW	2	66277669	missense	probably damaging	0.99
R5435:Scn1a	UTSW	2	66273534	missense	probably damaging	1.00
R5449:Scn1a	UTSW	2	66321002	missense	probably damaging	0.96
R5519:Scn1a	UTSW	2	66332213	missense	probably damaging	1.00
R5541:Scn1a	UTSW	2	66324633	missense	probably benign	0.07
R5556:Scn1a	UTSW	2	66324797	missense	probably benign	0.00
R5587:Scn1a	UTSW	2	66273081	missense	probably benign	0.01
R5972:Scn1a	UTSW	2	66351110	missense	possibly damaging	0.65
R5992:Scn1a	UTSW	2	66335456	missense	probably damaging	1.00
R6195:Scn1a	UTSW	2	66277618	missense	possibly damaging	0.59
R6233:Scn1a	UTSW	2	66277618	missense	possibly damaging	0.59
R6328:Scn1a	UTSW	2	66273316	missense	probably damaging	1.00
R6417:Scn1a	UTSW	2	66273198	missense	probably damaging	1.00
R6420:Scn1a	UTSW	2	66273198	missense	probably damaging	1.00
R6421:Scn1a	UTSW	2	66272927	missense	probably damaging	1.00
R6461:Scn1a	UTSW	2	66326122	missense	probably null	0.01
R6701:Scn1a	UTSW	2	66337960	missense	probably damaging	0.99
R6717:Scn1a	UTSW	2	66332287	missense	probably damaging	1.00
R6834:Scn1a	UTSW	2	66327742	missense	probably damaging	1.00
R6918:Scn1a	UTSW	2	66332213	missense	probably damaging	1.00
R6953:Scn1a	UTSW	2	66319469	missense	probably damaging	1.00
R6996:Scn1a	UTSW	2	66287731	missense	probably damaging	1.00
R7022:Scn1a	UTSW	2	66317899	missense	probably damaging	1.00
R7109:Scn1a	UTSW	2	66350942	missense	possibly damaging	0.62
R7115:Scn1a	UTSW	2	66324618	nonsense	probably null
R7239:Scn1a	UTSW	2	66277656	intron	probably null
R7434:Scn1a	UTSW	2	66273045	missense	probably benign
R7646:Scn1a	UTSW	2	66287758	missense	possibly damaging	0.93
R7711:Scn1a	UTSW	2	66303660	missense	probably benign
R7879:Scn1a	UTSW	2	66286005	nonsense	probably null
R7962:Scn1a	UTSW	2	66286005	nonsense	probably null
R8025:Scn1a	UTSW	2	66318213	missense	probably benign	0.02
R8055:Scn1a	UTSW	2	66319501	missense	probably damaging	1.00
Z1176:Scn1a	UTSW	2	66326128	missense	possibly damaging	0.92
Z1177:Scn1a	UTSW	2	66324952	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CGCAGAGGTGGTGATTTGGAACA -3'
(R):5'- ACCTCCACTCAGCCTTACTTGGT -3'

Sequencing Primer
(F):5'- ACAGGCAGATCATGCTGTTG -3'
(R):5'- gatgttctaaggaggagaggtg -3'

Posted On

2013-05-23