Incidental Mutation 'R0485:Scn1a'
Institutional Source Beutler Lab
Gene Symbol Scn1a
Ensembl Gene ENSMUSG00000064329
Gene Namesodium channel, voltage-gated, type I, alpha
MMRRC Submission 038684-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0485 (G1)
Quality Score225
Status Validated
Chromosomal Location66270778-66440840 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66273925 bp
Amino Acid Change Methionine to Valine at position 1664 (M1664V)
Ref Sequence ENSEMBL: ENSMUSP00000107985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077489] [ENSMUST00000094951] [ENSMUST00000112366] [ENSMUST00000112371] [ENSMUST00000156865]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077489
AA Change: M1653V

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076697
Gene: ENSMUSG00000064329
AA Change: M1653V

low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094951
AA Change: M1636V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092558
Gene: ENSMUSG00000064329
AA Change: M1636V

low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.3e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 691 2e-62 PFAM
Pfam:Ion_trans 774 963 6.7e-47 PFAM
Pfam:Na_trans_assoc 978 1200 1.2e-74 PFAM
Pfam:Ion_trans 1226 1454 1e-56 PFAM
PDB:1BYY|A 1456 1508 4e-31 PDB
Pfam:Ion_trans 1547 1757 1.1e-51 PFAM
Pfam:PKD_channel 1606 1764 3.8e-7 PFAM
low complexity region 1809 1821 N/A INTRINSIC
IQ 1886 1908 1.65e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112366
AA Change: M1664V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107985
Gene: ENSMUSG00000064329
AA Change: M1664V

low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 127 434 2.8e-82 PFAM
Pfam:Na_trans_cytopl 502 718 2e-91 PFAM
Pfam:Ion_trans 767 1002 6.5e-57 PFAM
Pfam:Na_trans_assoc 1006 1213 1.2e-60 PFAM
Pfam:Ion_trans 1217 1493 3.3e-67 PFAM
Pfam:Ion_trans 1540 1797 6.3e-56 PFAM
Pfam:PKD_channel 1637 1791 1.1e-6 PFAM
low complexity region 1837 1849 N/A INTRINSIC
IQ 1914 1936 1.65e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112371
AA Change: M1653V

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107990
Gene: ENSMUSG00000064329
AA Change: M1653V

low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156865
SMART Domains Protein: ENSMUSP00000144633
Gene: ENSMUSG00000064329

Pfam:Na_trans_assoc 1 182 2.2e-44 PFAM
Pfam:Ion_trans 186 462 1.3e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200839
Meta Mutation Damage Score 0.6719 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice show postnatal lethality, seizures and behavioral deficits whereas heterozygotes die prematurely with seizures and abnormal electrophysiology. In addition, knock-in mice exhibit increased susceptibility to febrile and flurothyl-induced seizures, and reduced inhibitory signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik A G 16: 3,907,647 V5A probably damaging Het
Abi3bp A G 16: 56,604,012 probably null Het
Acot11 G A 4: 106,762,027 R184C probably damaging Het
Adgre5 A T 8: 83,731,998 I133N probably damaging Het
Afap1 A T 5: 35,951,003 Q231L probably damaging Het
Alg12 T C 15: 88,811,427 T289A probably benign Het
Ank3 T A 10: 69,882,544 S542T possibly damaging Het
Ankmy2 G A 12: 36,182,390 R138Q possibly damaging Het
Ascc2 C T 11: 4,672,302 A456V probably benign Het
Atg4c G A 4: 99,224,482 V289I probably benign Het
Bbs7 A T 3: 36,602,873 Y269N probably damaging Het
Bcas3 T A 11: 85,495,850 D370E probably damaging Het
Bicc1 T G 10: 70,925,315 E955A probably damaging Het
Bok T C 1: 93,689,277 F115S probably damaging Het
Caap1 A T 4: 94,550,521 probably null Het
Cacna2d3 T A 14: 29,534,519 M95L possibly damaging Het
Calcrl T A 2: 84,370,091 D115V probably benign Het
Car7 A T 8: 104,543,538 M57L probably benign Het
Casq1 G T 1: 172,210,390 probably benign Het
Cep290 A T 10: 100,549,344 D1894V possibly damaging Het
Clec4a2 T A 6: 123,123,629 N14K probably damaging Het
Col16a1 G T 4: 130,090,497 probably benign Het
Col5a1 T C 2: 27,990,097 probably benign Het
Col5a2 A T 1: 45,378,482 I1311N probably damaging Het
Col5a3 T C 9: 20,782,708 T1050A probably damaging Het
Colgalt2 A T 1: 152,484,871 I220F probably damaging Het
Cpb1 A T 3: 20,275,628 V8E unknown Het
Dchs1 C T 7: 105,772,727 R162H probably benign Het
Dhx37 A G 5: 125,422,231 Y638H probably benign Het
Dhx40 T G 11: 86,771,262 probably benign Het
Ehd2 T A 7: 15,952,076 Q357L probably benign Het
Ewsr1 T C 11: 5,070,737 probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gid8 T A 2: 180,713,211 Y3* probably null Het
Gm10212 A C 19: 11,570,810 noncoding transcript Het
Gm4763 C A 7: 24,722,745 C193F possibly damaging Het
Gm597 G T 1: 28,778,142 Q270K probably damaging Het
Gm960 A T 19: 4,658,414 I350N probably damaging Het
Grin3b T A 10: 79,974,056 N465K possibly damaging Het
Hist1h1d A T 13: 23,555,750 K221* probably null Het
Htr4 A T 18: 62,428,154 N162I probably damaging Het
Itga3 T C 11: 95,061,970 D325G probably benign Het
Itpr3 T G 17: 27,111,929 V1737G probably damaging Het
Kcnab2 C T 4: 152,394,982 V251I probably benign Het
Kcnn2 A T 18: 45,560,148 I264L probably benign Het
Klhl41 T C 2: 69,671,256 Y354H probably damaging Het
Klra6 T C 6: 130,023,638 I68V probably benign Het
Letm2 G T 8: 25,592,558 P178Q probably damaging Het
Lrmp T C 6: 145,165,212 C248R probably damaging Het
Mbtps1 A T 8: 119,522,601 probably benign Het
Mecom C T 3: 29,980,972 probably benign Het
Mrps5 T A 2: 127,591,825 S45T possibly damaging Het
Msra T A 14: 64,440,761 I29F possibly damaging Het
Mup5 T C 4: 61,832,992 probably null Het
Myo1a T C 10: 127,719,242 probably benign Het
Myrip C A 9: 120,441,377 N564K probably benign Het
Naa20 T A 2: 145,915,672 D148E probably damaging Het
Naga T G 15: 82,336,755 probably benign Het
Npc1 A G 18: 12,213,446 V231A probably benign Het
Nphs1 T C 7: 30,467,515 F716L probably benign Het
Olfr284 T C 15: 98,340,929 H20R probably benign Het
Parn G C 16: 13,654,435 probably benign Het
Polk A T 13: 96,483,764 C664S probably benign Het
Prkar2b A G 12: 31,976,035 probably benign Het
Prkdc A G 16: 15,833,740 E3747G probably damaging Het
Prmt5 A T 14: 54,511,255 M362K probably damaging Het
Prob1 T C 18: 35,653,825 T459A possibly damaging Het
Rttn C T 18: 89,090,419 probably benign Het
Sez6 T A 11: 77,953,813 L154H probably damaging Het
Sh3tc1 A G 5: 35,702,012 probably benign Het
Shkbp1 C T 7: 27,348,581 G334D probably damaging Het
Slc8a1 A T 17: 81,647,993 F539I probably damaging Het
Sptan1 T C 2: 30,013,848 probably benign Het
Ssc5d C T 7: 4,937,471 T861M probably damaging Het
Tbx5 A T 5: 119,883,458 M510L probably benign Het
Tdp1 A G 12: 99,909,842 T351A probably benign Het
Tmc8 T A 11: 117,792,078 probably benign Het
Tmco5 T A 2: 116,890,107 D205E probably benign Het
Tmprss2 T C 16: 97,571,994 probably benign Het
Tph1 T A 7: 46,650,024 K364N probably benign Het
Trim24 T C 6: 37,957,066 L648P probably damaging Het
Trmt6 C A 2: 132,809,030 probably benign Het
Ube2i A T 17: 25,269,285 probably benign Het
Vcan A C 13: 89,704,660 L727R possibly damaging Het
Vmn2r28 T C 7: 5,488,690 Y186C probably damaging Het
Wars C A 12: 108,875,157 D232Y probably damaging Het
Xrcc5 T C 1: 72,338,945 probably benign Het
Zbtb24 T A 10: 41,464,536 S543T probably damaging Het
Zfp91 A G 19: 12,775,989 probably benign Het
Other mutations in Scn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Scn1a APN 2 66335531 critical splice acceptor site probably null
IGL00650:Scn1a APN 2 66280793 missense probably damaging 1.00
IGL00658:Scn1a APN 2 66286038 missense probably damaging 1.00
IGL00823:Scn1a APN 2 66324935 missense probably benign 0.04
IGL00907:Scn1a APN 2 66327797 missense probably damaging 1.00
IGL01339:Scn1a APN 2 66325960 missense probably benign 0.09
IGL01401:Scn1a APN 2 66289111 missense probably damaging 1.00
IGL01503:Scn1a APN 2 66322343 missense probably damaging 1.00
IGL01575:Scn1a APN 2 66273236 missense probably damaging 1.00
IGL01598:Scn1a APN 2 66302485 missense possibly damaging 0.63
IGL01613:Scn1a APN 2 66285937 missense probably damaging 1.00
IGL01796:Scn1a APN 2 66332301 splice site probably benign
IGL02079:Scn1a APN 2 66323360 missense probably benign 0.14
IGL02171:Scn1a APN 2 66273199 missense probably damaging 1.00
IGL02335:Scn1a APN 2 66277661 missense possibly damaging 0.93
IGL02406:Scn1a APN 2 66326036 missense possibly damaging 0.88
IGL02436:Scn1a APN 2 66351153 missense probably benign 0.01
IGL02507:Scn1a APN 2 66277813 missense probably damaging 1.00
IGL02646:Scn1a APN 2 66299618 splice site probably null
IGL02729:Scn1a APN 2 66299650 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66324762 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66318077 missense probably benign 0.00
IGL02752:Scn1a APN 2 66331412 missense probably damaging 1.00
IGL02815:Scn1a APN 2 66324858 missense probably damaging 1.00
IGL03163:Scn1a APN 2 66318074 missense probably benign 0.00
IGL03229:Scn1a APN 2 66299713 missense probably damaging 1.00
IGL03286:Scn1a APN 2 66277576 missense probably damaging 0.99
IGL03393:Scn1a APN 2 66318018 missense probably benign 0.19
BB008:Scn1a UTSW 2 66317812 missense probably damaging 0.99
BB018:Scn1a UTSW 2 66317812 missense probably damaging 0.99
PIT4791001:Scn1a UTSW 2 66273282 missense probably benign 0.18
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0107:Scn1a UTSW 2 66324633 missense probably benign 0.07
R0141:Scn1a UTSW 2 66289062 missense probably damaging 1.00
R0517:Scn1a UTSW 2 66302407 missense possibly damaging 0.88
R0532:Scn1a UTSW 2 66317823 missense probably damaging 1.00
R0746:Scn1a UTSW 2 66351126 missense probably benign 0.25
R0755:Scn1a UTSW 2 66321035 missense probably damaging 1.00
R0830:Scn1a UTSW 2 66299784 missense probably damaging 1.00
R0846:Scn1a UTSW 2 66324755 missense probably benign 0.43
R0918:Scn1a UTSW 2 66323307 splice site probably null
R1055:Scn1a UTSW 2 66337996 missense probably benign 0.08
R1432:Scn1a UTSW 2 66322429 missense probably damaging 1.00
R1497:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R1512:Scn1a UTSW 2 66331285 missense possibly damaging 0.82
R1525:Scn1a UTSW 2 66319462 nonsense probably null
R1567:Scn1a UTSW 2 66273331 missense probably damaging 1.00
R1702:Scn1a UTSW 2 66318223 missense probably damaging 1.00
R1744:Scn1a UTSW 2 66322276 missense probably benign 0.06
R1834:Scn1a UTSW 2 66324616 missense probably benign 0.04
R1834:Scn1a UTSW 2 66324617 missense probably benign 0.00
R1860:Scn1a UTSW 2 66317982 missense probably damaging 0.99
R1871:Scn1a UTSW 2 66318025 missense probably damaging 0.98
R1909:Scn1a UTSW 2 66331352 missense possibly damaging 0.58
R1967:Scn1a UTSW 2 66328425 missense probably damaging 1.00
R1976:Scn1a UTSW 2 66331271 missense probably benign 0.02
R2291:Scn1a UTSW 2 66288968 missense probably benign 0.44
R2302:Scn1a UTSW 2 66277745 missense probably damaging 1.00
R2367:Scn1a UTSW 2 66327679 missense probably damaging 1.00
R2418:Scn1a UTSW 2 66273843 missense probably damaging 0.98
R2517:Scn1a UTSW 2 66273832 missense probably damaging 1.00
R2568:Scn1a UTSW 2 66273469 missense probably damaging 1.00
R3083:Scn1a UTSW 2 66299637 missense probably damaging 1.00
R3903:Scn1a UTSW 2 66318132 missense probably benign 0.08
R3909:Scn1a UTSW 2 66273988 missense probably damaging 1.00
R3916:Scn1a UTSW 2 66277613 missense probably damaging 1.00
R3935:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R3936:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R4043:Scn1a UTSW 2 66326036 missense possibly damaging 0.60
R4429:Scn1a UTSW 2 66350985 missense possibly damaging 0.77
R4495:Scn1a UTSW 2 66280802 critical splice acceptor site probably null
R4662:Scn1a UTSW 2 66350988 missense probably benign 0.23
R4834:Scn1a UTSW 2 66328522 nonsense probably null
R4873:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R4875:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R5099:Scn1a UTSW 2 66277801 missense probably damaging 1.00
R5255:Scn1a UTSW 2 66277669 missense probably damaging 0.99
R5435:Scn1a UTSW 2 66273534 missense probably damaging 1.00
R5449:Scn1a UTSW 2 66321002 missense probably damaging 0.96
R5519:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R5541:Scn1a UTSW 2 66324633 missense probably benign 0.07
R5556:Scn1a UTSW 2 66324797 missense probably benign 0.00
R5587:Scn1a UTSW 2 66273081 missense probably benign 0.01
R5972:Scn1a UTSW 2 66351110 missense possibly damaging 0.65
R5992:Scn1a UTSW 2 66335456 missense probably damaging 1.00
R6195:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6233:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6328:Scn1a UTSW 2 66273316 missense probably damaging 1.00
R6417:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6420:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6421:Scn1a UTSW 2 66272927 missense probably damaging 1.00
R6461:Scn1a UTSW 2 66326122 missense probably null 0.01
R6701:Scn1a UTSW 2 66337960 missense probably damaging 0.99
R6717:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R6834:Scn1a UTSW 2 66327742 missense probably damaging 1.00
R6918:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R6953:Scn1a UTSW 2 66319469 missense probably damaging 1.00
R6996:Scn1a UTSW 2 66287731 missense probably damaging 1.00
R7022:Scn1a UTSW 2 66317899 missense probably damaging 1.00
R7109:Scn1a UTSW 2 66350942 missense possibly damaging 0.62
R7115:Scn1a UTSW 2 66324618 nonsense probably null
R7239:Scn1a UTSW 2 66277656 splice site probably null
R7434:Scn1a UTSW 2 66273045 missense probably benign
R7646:Scn1a UTSW 2 66287758 missense possibly damaging 0.93
R7711:Scn1a UTSW 2 66303660 missense probably benign
R7879:Scn1a UTSW 2 66286005 nonsense probably null
R7931:Scn1a UTSW 2 66317812 missense probably damaging 0.99
R7962:Scn1a UTSW 2 66328442 missense probably damaging 1.00
R8025:Scn1a UTSW 2 66318213 missense probably benign 0.02
R8055:Scn1a UTSW 2 66319501 missense probably damaging 1.00
R8095:Scn1a UTSW 2 66302465 missense possibly damaging 0.93
R8167:Scn1a UTSW 2 66324838 missense probably damaging 0.98
R8339:Scn1a UTSW 2 66286029 missense probably damaging 1.00
R8363:Scn1a UTSW 2 66322257 missense probably damaging 1.00
R8516:Scn1a UTSW 2 66326134 missense possibly damaging 0.79
R8559:Scn1a UTSW 2 66287733 missense probably damaging 1.00
R8726:Scn1a UTSW 2 66303639 missense probably benign
R8733:Scn1a UTSW 2 66324600 missense probably benign
R8779:Scn1a UTSW 2 66350913 critical splice donor site probably benign
Z1176:Scn1a UTSW 2 66326128 missense possibly damaging 0.92
Z1177:Scn1a UTSW 2 66324952 critical splice acceptor site probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gatgttctaaggaggagaggtg -3'
Posted On2013-05-23