Mutagenetix > Incidental Mutations

Incidental Mutation 'R0485:Bbs7'

42187

Institutional Source

Beutler Lab

Gene Symbol

Bbs7

Ensembl Gene

ENSMUSG00000037325

Gene Name

Bardet-Biedl syndrome 7 (human)

Synonyms

8430406N16Rik

MMRRC Submission

038684-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0485 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36573142-36613477 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 36602873 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 269 (Y269N)

Ref Sequence

ENSEMBL: ENSMUSP00000103791 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040148] [ENSMUST00000108155] [ENSMUST00000108156]

Predicted Effect

probably damaging
Transcript: ENSMUST00000040148
AA Change: Y269N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000047273
Gene: ENSMUSG00000037325
AA Change: Y269N

Domain	Start	End	E-Value	Type
low complexity region	33	44	N/A	INTRINSIC
coiled coil region	330	365	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108155
AA Change: Y269N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103790
Gene: ENSMUSG00000037325
AA Change: Y269N

Domain	Start	End	E-Value	Type
low complexity region	33	44	N/A	INTRINSIC
coiled coil region	330	365	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108156
AA Change: Y269N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103791
Gene: ENSMUSG00000037325
AA Change: Y269N

Domain	Start	End	E-Value	Type
low complexity region	33	44	N/A	INTRINSIC
coiled coil region	330	365	N/A	INTRINSIC

Meta Mutation Damage Score

0.9675

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.4%

Validation Efficiency

100% (95/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of eight proteins that form the BBSome complex containing BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, BBS9 and BBIP10. The BBSome complex is believed to recruit Rab8(GTP) to the primary cilium and promote ciliogenesis. The BBSome complex assembly is mediated by a complex composed of three chaperonin-like BBS proteins (BBS6, BBS10, and BBS12) and CCT/TRiC family chaperonins. Mutations in this gene are implicated in Bardet-Biedl syndrome, a genetic disorder whose symptoms include obesity, retinal degeneration, polydactyly and nephropathy; however, mutations in this gene and the BBS8 gene are thought to play a minor role and mutations in chaperonin-like BBS genes are found to be a major contributor to disease development in a multiethnic Bardet-Biedl syndrome patient population. Two transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial preweaning lethality, retinal degeneration, obesity, ventriculomegaly, abnormal brain ependyma motile cilium morphology, and male infertility characterized by abnormal sperm flagellar axoneme structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700037C18Rik	A	G	16: 3,907,647	V5A	probably damaging	Het
Abi3bp	A	G	16: 56,604,012		probably null	Het
Acot11	G	A	4: 106,762,027	R184C	probably damaging	Het
Adgre5	A	T	8: 83,731,998	I133N	probably damaging	Het
Afap1	A	T	5: 35,951,003	Q231L	probably damaging	Het
Alg12	T	C	15: 88,811,427	T289A	probably benign	Het
Ank3	T	A	10: 69,882,544	S542T	possibly damaging	Het
Ankmy2	G	A	12: 36,182,390	R138Q	possibly damaging	Het
Ascc2	C	T	11: 4,672,302	A456V	probably benign	Het
Atg4c	G	A	4: 99,224,482	V289I	probably benign	Het
Bcas3	T	A	11: 85,495,850	D370E	probably damaging	Het
Bicc1	T	G	10: 70,925,315	E955A	probably damaging	Het
Bok	T	C	1: 93,689,277	F115S	probably damaging	Het
Caap1	A	T	4: 94,550,521		probably null	Het
Cacna2d3	T	A	14: 29,534,519	M95L	possibly damaging	Het
Calcrl	T	A	2: 84,370,091	D115V	probably benign	Het
Car7	A	T	8: 104,543,538	M57L	probably benign	Het
Casq1	G	T	1: 172,210,390		probably benign	Het
Cep290	A	T	10: 100,549,344	D1894V	possibly damaging	Het
Clec4a2	T	A	6: 123,123,629	N14K	probably damaging	Het
Col16a1	G	T	4: 130,090,497		probably benign	Het
Col5a1	T	C	2: 27,990,097		probably benign	Het
Col5a2	A	T	1: 45,378,482	I1311N	probably damaging	Het
Col5a3	T	C	9: 20,782,708	T1050A	probably damaging	Het
Colgalt2	A	T	1: 152,484,871	I220F	probably damaging	Het
Cpb1	A	T	3: 20,275,628	V8E	unknown	Het
Dchs1	C	T	7: 105,772,727	R162H	probably benign	Het
Dhx37	A	G	5: 125,422,231	Y638H	probably benign	Het
Dhx40	T	G	11: 86,771,262		probably benign	Het
Ehd2	T	A	7: 15,952,076	Q357L	probably benign	Het
Ewsr1	T	C	11: 5,070,737		probably benign	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Gid8	T	A	2: 180,713,211	Y3*	probably null	Het
Gm10212	A	C	19: 11,570,810		noncoding transcript	Het
Gm4763	C	A	7: 24,722,745	C193F	possibly damaging	Het
Gm597	G	T	1: 28,778,142	Q270K	probably damaging	Het
Gm960	A	T	19: 4,658,414	I350N	probably damaging	Het
Grin3b	T	A	10: 79,974,056	N465K	possibly damaging	Het
Hist1h1d	A	T	13: 23,555,750	K221*	probably null	Het
Htr4	A	T	18: 62,428,154	N162I	probably damaging	Het
Itga3	T	C	11: 95,061,970	D325G	probably benign	Het
Itpr3	T	G	17: 27,111,929	V1737G	probably damaging	Het
Kcnab2	C	T	4: 152,394,982	V251I	probably benign	Het
Kcnn2	A	T	18: 45,560,148	I264L	probably benign	Het
Klhl41	T	C	2: 69,671,256	Y354H	probably damaging	Het
Klra6	T	C	6: 130,023,638	I68V	probably benign	Het
Letm2	G	T	8: 25,592,558	P178Q	probably damaging	Het
Lrmp	T	C	6: 145,165,212	C248R	probably damaging	Het
Mbtps1	A	T	8: 119,522,601		probably benign	Het
Mecom	C	T	3: 29,980,972		probably benign	Het
Mrps5	T	A	2: 127,591,825	S45T	possibly damaging	Het
Msra	T	A	14: 64,440,761	I29F	possibly damaging	Het
Mup5	T	C	4: 61,832,992		probably null	Het
Myo1a	T	C	10: 127,719,242		probably benign	Het
Myrip	C	A	9: 120,441,377	N564K	probably benign	Het
Naa20	T	A	2: 145,915,672	D148E	probably damaging	Het
Naga	T	G	15: 82,336,755		probably benign	Het
Npc1	A	G	18: 12,213,446	V231A	probably benign	Het
Nphs1	T	C	7: 30,467,515	F716L	probably benign	Het
Olfr284	T	C	15: 98,340,929	H20R	probably benign	Het
Parn	G	C	16: 13,654,435		probably benign	Het
Polk	A	T	13: 96,483,764	C664S	probably benign	Het
Prkar2b	A	G	12: 31,976,035		probably benign	Het
Prkdc	A	G	16: 15,833,740	E3747G	probably damaging	Het
Prmt5	A	T	14: 54,511,255	M362K	probably damaging	Het
Prob1	T	C	18: 35,653,825	T459A	possibly damaging	Het
Rttn	C	T	18: 89,090,419		probably benign	Het
Scn1a	T	C	2: 66,273,925	M1664V	probably damaging	Het
Sez6	T	A	11: 77,953,813	L154H	probably damaging	Het
Sh3tc1	A	G	5: 35,702,012		probably benign	Het
Shkbp1	C	T	7: 27,348,581	G334D	probably damaging	Het
Slc8a1	A	T	17: 81,647,993	F539I	probably damaging	Het
Sptan1	T	C	2: 30,013,848		probably benign	Het
Ssc5d	C	T	7: 4,937,471	T861M	probably damaging	Het
Tbx5	A	T	5: 119,883,458	M510L	probably benign	Het
Tdp1	A	G	12: 99,909,842	T351A	probably benign	Het
Tmc8	T	A	11: 117,792,078		probably benign	Het
Tmco5	T	A	2: 116,890,107	D205E	probably benign	Het
Tmprss2	T	C	16: 97,571,994		probably benign	Het
Tph1	T	A	7: 46,650,024	K364N	probably benign	Het
Trim24	T	C	6: 37,957,066	L648P	probably damaging	Het
Trmt6	C	A	2: 132,809,030		probably benign	Het
Ube2i	A	T	17: 25,269,285		probably benign	Het
Vcan	A	C	13: 89,704,660	L727R	possibly damaging	Het
Vmn2r28	T	C	7: 5,488,690	Y186C	probably damaging	Het
Wars	C	A	12: 108,875,157	D232Y	probably damaging	Het
Xrcc5	T	C	1: 72,338,945		probably benign	Het
Zbtb24	T	A	10: 41,464,536	S543T	probably damaging	Het
Zfp91	A	G	19: 12,775,989		probably benign	Het

Other mutations in Bbs7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00791:Bbs7	APN	3	36575287	makesense	probably null
IGL01533:Bbs7	APN	3	36610235	missense	possibly damaging	0.66
IGL01559:Bbs7	APN	3	36594510	missense	probably damaging	1.00
IGL01793:Bbs7	APN	3	36605682	critical splice donor site	probably null
IGL01867:Bbs7	APN	3	36573547	missense	probably benign	0.21
IGL01955:Bbs7	APN	3	36610322	missense	probably benign	0.16
IGL02207:Bbs7	APN	3	36604490	missense	probably benign	0.10
IGL02212:Bbs7	APN	3	36594409	missense	probably benign
IGL02451:Bbs7	APN	3	36610592	missense	possibly damaging	0.94
IGL03267:Bbs7	APN	3	36573505	missense	probably damaging	1.00
R0010:Bbs7	UTSW	3	36607717	splice site	probably null
R0243:Bbs7	UTSW	3	36605734	missense	probably benign
R0326:Bbs7	UTSW	3	36592376	missense	possibly damaging	0.46
R0372:Bbs7	UTSW	3	36602832	missense	probably benign	0.00
R0398:Bbs7	UTSW	3	36590717	missense	probably benign
R0453:Bbs7	UTSW	3	36607669	missense	possibly damaging	0.79
R0592:Bbs7	UTSW	3	36610297	missense	probably benign	0.05
R0619:Bbs7	UTSW	3	36607576	missense	probably benign	0.02
R0720:Bbs7	UTSW	3	36592423	missense	probably damaging	1.00
R0963:Bbs7	UTSW	3	36613263	missense	probably benign	0.22
R1177:Bbs7	UTSW	3	36610180	splice site	probably null
R1242:Bbs7	UTSW	3	36578427	missense	probably damaging	1.00
R1336:Bbs7	UTSW	3	36604444	missense	probably benign
R1401:Bbs7	UTSW	3	36573557	missense	probably benign	0.09
R1564:Bbs7	UTSW	3	36575795	missense	probably damaging	0.99
R2417:Bbs7	UTSW	3	36592397	missense	probably damaging	1.00
R3736:Bbs7	UTSW	3	36607670	missense	possibly damaging	0.87
R4282:Bbs7	UTSW	3	36573571	missense	probably damaging	1.00
R5412:Bbs7	UTSW	3	36599373	missense	probably benign
R5444:Bbs7	UTSW	3	36612050	missense	possibly damaging	0.50
R5932:Bbs7	UTSW	3	36582698	missense	probably benign	0.01
R6030:Bbs7	UTSW	3	36602911	missense	probably damaging	0.98
R6030:Bbs7	UTSW	3	36602911	missense	probably damaging	0.98
R6148:Bbs7	UTSW	3	36613266	missense	probably damaging	1.00
R6173:Bbs7	UTSW	3	36592374	nonsense	probably null
R6897:Bbs7	UTSW	3	36598311	missense	probably benign	0.07
R6912:Bbs7	UTSW	3	36605704	missense	probably benign	0.00
R7224:Bbs7	UTSW	3	36605728	missense	possibly damaging	0.48
R7268:Bbs7	UTSW	3	36604426	missense	probably benign
R7456:Bbs7	UTSW	3	36594378	missense	probably damaging	0.99
R7959:Bbs7	UTSW	3	36602936	missense	probably damaging	1.00
R8013:Bbs7	UTSW	3	36594387	missense	probably damaging	1.00
R8014:Bbs7	UTSW	3	36594387	missense	probably damaging	1.00
R8182:Bbs7	UTSW	3	36610223	missense	probably damaging	1.00
X0003:Bbs7	UTSW	3	36575845	nonsense	probably null
Z1177:Bbs7	UTSW	3	36602920	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGTTTACCAGCGAGCAATGTCC -3'
(R):5'- GGGAAGCACCCAATTATGTGCAAAG -3'

Sequencing Primer
(F):5'- actcctcatccttctgcctc -3'
(R):5'- aaatttttGATGACTGTGGTATGAAG -3'

Posted On

2013-05-23