Incidental Mutation 'R0485:Bbs7'
Institutional Source Beutler Lab
Gene Symbol Bbs7
Ensembl Gene ENSMUSG00000037325
Gene NameBardet-Biedl syndrome 7 (human)
MMRRC Submission 038684-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0485 (G1)
Quality Score225
Status Validated
Chromosomal Location36573142-36613477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36602873 bp
Amino Acid Change Tyrosine to Asparagine at position 269 (Y269N)
Ref Sequence ENSEMBL: ENSMUSP00000103791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040148] [ENSMUST00000108155] [ENSMUST00000108156]
Predicted Effect probably damaging
Transcript: ENSMUST00000040148
AA Change: Y269N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047273
Gene: ENSMUSG00000037325
AA Change: Y269N

low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108155
AA Change: Y269N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103790
Gene: ENSMUSG00000037325
AA Change: Y269N

low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108156
AA Change: Y269N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103791
Gene: ENSMUSG00000037325
AA Change: Y269N

low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Meta Mutation Damage Score 0.9675 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of eight proteins that form the BBSome complex containing BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, BBS9 and BBIP10. The BBSome complex is believed to recruit Rab8(GTP) to the primary cilium and promote ciliogenesis. The BBSome complex assembly is mediated by a complex composed of three chaperonin-like BBS proteins (BBS6, BBS10, and BBS12) and CCT/TRiC family chaperonins. Mutations in this gene are implicated in Bardet-Biedl syndrome, a genetic disorder whose symptoms include obesity, retinal degeneration, polydactyly and nephropathy; however, mutations in this gene and the BBS8 gene are thought to play a minor role and mutations in chaperonin-like BBS genes are found to be a major contributor to disease development in a multiethnic Bardet-Biedl syndrome patient population. Two transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial preweaning lethality, retinal degeneration, obesity, ventriculomegaly, abnormal brain ependyma motile cilium morphology, and male infertility characterized by abnormal sperm flagellar axoneme structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik A G 16: 3,907,647 V5A probably damaging Het
Abi3bp A G 16: 56,604,012 probably null Het
Acot11 G A 4: 106,762,027 R184C probably damaging Het
Adgre5 A T 8: 83,731,998 I133N probably damaging Het
Afap1 A T 5: 35,951,003 Q231L probably damaging Het
Alg12 T C 15: 88,811,427 T289A probably benign Het
Ank3 T A 10: 69,882,544 S542T possibly damaging Het
Ankmy2 G A 12: 36,182,390 R138Q possibly damaging Het
Ascc2 C T 11: 4,672,302 A456V probably benign Het
Atg4c G A 4: 99,224,482 V289I probably benign Het
Bcas3 T A 11: 85,495,850 D370E probably damaging Het
Bicc1 T G 10: 70,925,315 E955A probably damaging Het
Bok T C 1: 93,689,277 F115S probably damaging Het
Caap1 A T 4: 94,550,521 probably null Het
Cacna2d3 T A 14: 29,534,519 M95L possibly damaging Het
Calcrl T A 2: 84,370,091 D115V probably benign Het
Car7 A T 8: 104,543,538 M57L probably benign Het
Casq1 G T 1: 172,210,390 probably benign Het
Cep290 A T 10: 100,549,344 D1894V possibly damaging Het
Clec4a2 T A 6: 123,123,629 N14K probably damaging Het
Col16a1 G T 4: 130,090,497 probably benign Het
Col5a1 T C 2: 27,990,097 probably benign Het
Col5a2 A T 1: 45,378,482 I1311N probably damaging Het
Col5a3 T C 9: 20,782,708 T1050A probably damaging Het
Colgalt2 A T 1: 152,484,871 I220F probably damaging Het
Cpb1 A T 3: 20,275,628 V8E unknown Het
Dchs1 C T 7: 105,772,727 R162H probably benign Het
Dhx37 A G 5: 125,422,231 Y638H probably benign Het
Dhx40 T G 11: 86,771,262 probably benign Het
Ehd2 T A 7: 15,952,076 Q357L probably benign Het
Ewsr1 T C 11: 5,070,737 probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gid8 T A 2: 180,713,211 Y3* probably null Het
Gm10212 A C 19: 11,570,810 noncoding transcript Het
Gm4763 C A 7: 24,722,745 C193F possibly damaging Het
Gm597 G T 1: 28,778,142 Q270K probably damaging Het
Gm960 A T 19: 4,658,414 I350N probably damaging Het
Grin3b T A 10: 79,974,056 N465K possibly damaging Het
Hist1h1d A T 13: 23,555,750 K221* probably null Het
Htr4 A T 18: 62,428,154 N162I probably damaging Het
Itga3 T C 11: 95,061,970 D325G probably benign Het
Itpr3 T G 17: 27,111,929 V1737G probably damaging Het
Kcnab2 C T 4: 152,394,982 V251I probably benign Het
Kcnn2 A T 18: 45,560,148 I264L probably benign Het
Klhl41 T C 2: 69,671,256 Y354H probably damaging Het
Klra6 T C 6: 130,023,638 I68V probably benign Het
Letm2 G T 8: 25,592,558 P178Q probably damaging Het
Lrmp T C 6: 145,165,212 C248R probably damaging Het
Mbtps1 A T 8: 119,522,601 probably benign Het
Mecom C T 3: 29,980,972 probably benign Het
Mrps5 T A 2: 127,591,825 S45T possibly damaging Het
Msra T A 14: 64,440,761 I29F possibly damaging Het
Mup5 T C 4: 61,832,992 probably null Het
Myo1a T C 10: 127,719,242 probably benign Het
Myrip C A 9: 120,441,377 N564K probably benign Het
Naa20 T A 2: 145,915,672 D148E probably damaging Het
Naga T G 15: 82,336,755 probably benign Het
Npc1 A G 18: 12,213,446 V231A probably benign Het
Nphs1 T C 7: 30,467,515 F716L probably benign Het
Olfr284 T C 15: 98,340,929 H20R probably benign Het
Parn G C 16: 13,654,435 probably benign Het
Polk A T 13: 96,483,764 C664S probably benign Het
Prkar2b A G 12: 31,976,035 probably benign Het
Prkdc A G 16: 15,833,740 E3747G probably damaging Het
Prmt5 A T 14: 54,511,255 M362K probably damaging Het
Prob1 T C 18: 35,653,825 T459A possibly damaging Het
Rttn C T 18: 89,090,419 probably benign Het
Scn1a T C 2: 66,273,925 M1664V probably damaging Het
Sez6 T A 11: 77,953,813 L154H probably damaging Het
Sh3tc1 A G 5: 35,702,012 probably benign Het
Shkbp1 C T 7: 27,348,581 G334D probably damaging Het
Slc8a1 A T 17: 81,647,993 F539I probably damaging Het
Sptan1 T C 2: 30,013,848 probably benign Het
Ssc5d C T 7: 4,937,471 T861M probably damaging Het
Tbx5 A T 5: 119,883,458 M510L probably benign Het
Tdp1 A G 12: 99,909,842 T351A probably benign Het
Tmc8 T A 11: 117,792,078 probably benign Het
Tmco5 T A 2: 116,890,107 D205E probably benign Het
Tmprss2 T C 16: 97,571,994 probably benign Het
Tph1 T A 7: 46,650,024 K364N probably benign Het
Trim24 T C 6: 37,957,066 L648P probably damaging Het
Trmt6 C A 2: 132,809,030 probably benign Het
Ube2i A T 17: 25,269,285 probably benign Het
Vcan A C 13: 89,704,660 L727R possibly damaging Het
Vmn2r28 T C 7: 5,488,690 Y186C probably damaging Het
Wars C A 12: 108,875,157 D232Y probably damaging Het
Xrcc5 T C 1: 72,338,945 probably benign Het
Zbtb24 T A 10: 41,464,536 S543T probably damaging Het
Zfp91 A G 19: 12,775,989 probably benign Het
Other mutations in Bbs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Bbs7 APN 3 36575287 makesense probably null
IGL01533:Bbs7 APN 3 36610235 missense possibly damaging 0.66
IGL01559:Bbs7 APN 3 36594510 missense probably damaging 1.00
IGL01793:Bbs7 APN 3 36605682 critical splice donor site probably null
IGL01867:Bbs7 APN 3 36573547 missense probably benign 0.21
IGL01955:Bbs7 APN 3 36610322 missense probably benign 0.16
IGL02207:Bbs7 APN 3 36604490 missense probably benign 0.10
IGL02212:Bbs7 APN 3 36594409 missense probably benign
IGL02451:Bbs7 APN 3 36610592 missense possibly damaging 0.94
IGL03267:Bbs7 APN 3 36573505 missense probably damaging 1.00
R0010:Bbs7 UTSW 3 36607717 splice site probably null
R0243:Bbs7 UTSW 3 36605734 missense probably benign
R0326:Bbs7 UTSW 3 36592376 missense possibly damaging 0.46
R0372:Bbs7 UTSW 3 36602832 missense probably benign 0.00
R0398:Bbs7 UTSW 3 36590717 missense probably benign
R0453:Bbs7 UTSW 3 36607669 missense possibly damaging 0.79
R0592:Bbs7 UTSW 3 36610297 missense probably benign 0.05
R0619:Bbs7 UTSW 3 36607576 missense probably benign 0.02
R0720:Bbs7 UTSW 3 36592423 missense probably damaging 1.00
R0963:Bbs7 UTSW 3 36613263 missense probably benign 0.22
R1177:Bbs7 UTSW 3 36610180 splice site probably null
R1242:Bbs7 UTSW 3 36578427 missense probably damaging 1.00
R1336:Bbs7 UTSW 3 36604444 missense probably benign
R1401:Bbs7 UTSW 3 36573557 missense probably benign 0.09
R1564:Bbs7 UTSW 3 36575795 missense probably damaging 0.99
R2417:Bbs7 UTSW 3 36592397 missense probably damaging 1.00
R3736:Bbs7 UTSW 3 36607670 missense possibly damaging 0.87
R4282:Bbs7 UTSW 3 36573571 missense probably damaging 1.00
R5412:Bbs7 UTSW 3 36599373 missense probably benign
R5444:Bbs7 UTSW 3 36612050 missense possibly damaging 0.50
R5932:Bbs7 UTSW 3 36582698 missense probably benign 0.01
R6030:Bbs7 UTSW 3 36602911 missense probably damaging 0.98
R6030:Bbs7 UTSW 3 36602911 missense probably damaging 0.98
R6148:Bbs7 UTSW 3 36613266 missense probably damaging 1.00
R6173:Bbs7 UTSW 3 36592374 nonsense probably null
R6897:Bbs7 UTSW 3 36598311 missense probably benign 0.07
R6912:Bbs7 UTSW 3 36605704 missense probably benign 0.00
R7224:Bbs7 UTSW 3 36605728 missense possibly damaging 0.48
R7268:Bbs7 UTSW 3 36604426 missense probably benign
R7456:Bbs7 UTSW 3 36594378 missense probably damaging 0.99
R7959:Bbs7 UTSW 3 36602936 missense probably damaging 1.00
R8013:Bbs7 UTSW 3 36594387 missense probably damaging 1.00
R8014:Bbs7 UTSW 3 36594387 missense probably damaging 1.00
R8182:Bbs7 UTSW 3 36610223 missense probably damaging 1.00
X0003:Bbs7 UTSW 3 36575845 nonsense probably null
Z1177:Bbs7 UTSW 3 36602920 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- actcctcatccttctgcctc -3'
(R):5'- aaatttttGATGACTGTGGTATGAAG -3'
Posted On2013-05-23