Incidental Mutation 'R5325:Sirpb1a'
ID 421872
Institutional Source Beutler Lab
Gene Symbol Sirpb1a
Ensembl Gene ENSMUSG00000095788
Gene Name signal-regulatory protein beta 1A
Synonyms 9930027N05Rik, Sirpb1
MMRRC Submission 042908-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R5325 (G1)
Quality Score 191
Status Validated
Chromosome 3
Chromosomal Location 15436887-15491487 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 15476503 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 98 (T98I)
Ref Sequence ENSEMBL: ENSMUSP00000141659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099201] [ENSMUST00000192700] [ENSMUST00000194144]
AlphaFold A0A0A6YYP6
Predicted Effect probably benign
Transcript: ENSMUST00000099201
AA Change: T165I

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000096807
Gene: ENSMUSG00000095788
AA Change: T165I

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
IG 37 143 2.48e-8 SMART
IGc1 163 236 1.17e-4 SMART
IGc1 269 339 4.91e-4 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191958
Predicted Effect probably benign
Transcript: ENSMUST00000192700
AA Change: T165I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000141504
Gene: ENSMUSG00000095788
AA Change: T165I

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
IG 37 143 2.48e-8 SMART
IGc1 163 236 1.17e-4 SMART
IGc1 269 339 4.91e-4 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000194144
AA Change: T98I

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141659
Gene: ENSMUSG00000095788
AA Change: T98I

DomainStartEndE-ValueType
Pfam:Ig_2 15 66 6.6e-1 PFAM
Pfam:Ig_3 21 52 1.7e-2 PFAM
Pfam:V-set 23 75 1.2e-7 PFAM
IGc1 96 169 4.8e-7 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T A 11: 105,896,079 (GRCm39) M675K probably benign Het
Ccdc186 A T 19: 56,801,613 (GRCm39) I168N probably damaging Het
Ccnb1 C G 13: 100,918,283 (GRCm39) Q121H possibly damaging Het
Cep83 A G 10: 94,573,768 (GRCm39) E219G probably damaging Het
Ctsj T C 13: 61,151,839 (GRCm39) T73A possibly damaging Het
Ddr2 T A 1: 169,829,406 (GRCm39) T283S probably benign Het
Ehbp1 T A 11: 22,045,370 (GRCm39) D768V possibly damaging Het
Evpl T C 11: 116,112,191 (GRCm39) D1833G probably damaging Het
Exoc1 A G 5: 76,685,549 (GRCm39) N87S probably benign Het
Fam98b A C 2: 117,101,132 (GRCm39) I315L possibly damaging Het
Fancg A G 4: 43,006,564 (GRCm39) V330A probably damaging Het
Fbxo30 G A 10: 11,166,846 (GRCm39) V523I possibly damaging Het
Fbxw27 A G 9: 109,599,161 (GRCm39) C419R probably damaging Het
Flt3 C A 5: 147,312,459 (GRCm39) V161L probably benign Het
Fndc7 G A 3: 108,790,765 (GRCm39) T87I probably damaging Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Gm6457 A T 18: 14,703,498 (GRCm39) noncoding transcript Het
Gpr63 T C 4: 25,007,294 (GRCm39) V6A probably benign Het
Grhl3 T A 4: 135,286,415 (GRCm39) K89* probably null Het
H2-M10.2 C A 17: 36,596,471 (GRCm39) V125L probably benign Het
Hrh4 C T 18: 13,155,054 (GRCm39) Q198* probably null Het
Lrch4 A G 5: 137,636,168 (GRCm39) E373G probably damaging Het
Mroh9 C G 1: 162,888,329 (GRCm39) G249R probably damaging Het
Noa1 A C 5: 77,452,042 (GRCm39) D547E probably damaging Het
Nr2e1 G A 10: 42,448,780 (GRCm39) R153W probably damaging Het
Nudt9 A C 5: 104,198,487 (GRCm39) M1L possibly damaging Het
Odf2 T A 2: 29,802,583 (GRCm39) D282E probably benign Het
Olfr908 A T 9: 38,427,454 (GRCm39) N42I probably damaging Het
Or13a25 C A 7: 140,247,705 (GRCm39) H168Q probably benign Het
Or6ae1 T A 7: 139,742,026 (GRCm39) Y279F probably damaging Het
Osbpl5 C G 7: 143,245,665 (GRCm39) A816P probably damaging Het
Pan2 T C 10: 128,153,503 (GRCm39) I924T possibly damaging Het
Ppat A G 5: 77,076,269 (GRCm39) probably benign Het
Rad50 T G 11: 53,583,690 (GRCm39) I364L probably benign Het
Rnf7l A G 10: 63,257,458 (GRCm39) S21P probably benign Het
Robo2 A G 16: 73,770,673 (GRCm39) I484T possibly damaging Het
Ryr2 A T 13: 11,705,249 (GRCm39) M2839K probably damaging Het
Sin3b A G 8: 73,477,154 (GRCm39) D807G probably damaging Het
Smim17 G A 7: 6,432,321 (GRCm39) V88M probably damaging Het
Spib T C 7: 44,177,505 (GRCm39) T229A probably damaging Het
St14 A T 9: 31,008,274 (GRCm39) probably null Het
Syne4 A T 7: 30,018,401 (GRCm39) Y381F probably damaging Het
Sytl1 T C 4: 132,988,382 (GRCm39) probably benign Het
Tnpo3 A C 6: 29,602,012 (GRCm39) probably benign Het
Trim12a T A 7: 103,953,413 (GRCm39) I233F probably damaging Het
Tspan1 T A 4: 116,021,536 (GRCm39) N82Y probably damaging Het
Vmn1r60 T A 7: 5,547,201 (GRCm39) M300L probably benign Het
Wdr17 G A 8: 55,112,716 (GRCm39) A788V possibly damaging Het
Wwtr1 A T 3: 57,482,658 (GRCm39) V63E probably benign Het
Ylpm1 A G 12: 85,060,735 (GRCm39) probably benign Het
Zfp956 T C 6: 47,928,012 (GRCm39) probably benign Het
Other mutations in Sirpb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Sirpb1a APN 3 15,475,788 (GRCm39) unclassified probably benign
IGL00597:Sirpb1a APN 3 15,481,977 (GRCm39) missense probably damaging 1.00
IGL01521:Sirpb1a APN 3 15,475,561 (GRCm39) missense probably benign 0.00
IGL01678:Sirpb1a APN 3 15,476,370 (GRCm39) missense probably damaging 1.00
IGL02154:Sirpb1a APN 3 15,475,504 (GRCm39) missense probably damaging 1.00
IGL02275:Sirpb1a APN 3 15,475,469 (GRCm39) critical splice donor site probably null
IGL02419:Sirpb1a APN 3 15,491,398 (GRCm39) missense probably benign
IGL02657:Sirpb1a APN 3 15,482,111 (GRCm39) missense possibly damaging 0.85
IGL03086:Sirpb1a APN 3 15,491,388 (GRCm39) splice site probably null
PIT4142001:Sirpb1a UTSW 3 15,476,258 (GRCm39) missense probably benign 0.00
R0270:Sirpb1a UTSW 3 15,475,587 (GRCm39) missense probably damaging 1.00
R1975:Sirpb1a UTSW 3 15,444,141 (GRCm39) missense probably benign 0.00
R3432:Sirpb1a UTSW 3 15,491,447 (GRCm39) missense probably damaging 0.98
R4613:Sirpb1a UTSW 3 15,482,097 (GRCm39) missense probably benign 0.09
R6223:Sirpb1a UTSW 3 15,444,086 (GRCm39) missense probably benign 0.02
R6526:Sirpb1a UTSW 3 15,444,080 (GRCm39) missense probably damaging 0.99
R6903:Sirpb1a UTSW 3 15,481,984 (GRCm39) missense probably damaging 0.99
R7349:Sirpb1a UTSW 3 15,475,664 (GRCm39) missense probably damaging 0.99
R7513:Sirpb1a UTSW 3 15,476,503 (GRCm39) missense possibly damaging 0.90
R8250:Sirpb1a UTSW 3 15,444,104 (GRCm39) missense possibly damaging 0.92
R8700:Sirpb1a UTSW 3 15,476,419 (GRCm39) missense probably damaging 0.97
R9263:Sirpb1a UTSW 3 15,481,992 (GRCm39) missense probably damaging 1.00
R9553:Sirpb1a UTSW 3 15,476,320 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGACATGATCCACTTCACAGATG -3'
(R):5'- GGTTCCTAGTTGCCTGGTAAC -3'

Sequencing Primer
(F):5'- ATGATCTGAGAGCGGACATCCC -3'
(R):5'- GGTAACAACAATCCTGACAGTAAAC -3'
Posted On 2016-08-04