Incidental Mutation 'R5325:Gpr63'
ID421875
Institutional Source Beutler Lab
Gene Symbol Gpr63
Ensembl Gene ENSMUSG00000040372
Gene NameG protein-coupled receptor 63
SynonymsPSP24beta
MMRRC Submission 042908-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5325 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location24966407-25009233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25007294 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 6 (V6A)
Ref Sequence ENSEMBL: ENSMUSP00000039312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038920]
Predicted Effect probably benign
Transcript: ENSMUST00000038920
AA Change: V6A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000039312
Gene: ENSMUSG00000040372
AA Change: V6A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 98 392 1.3e-8 PFAM
Pfam:7tm_1 104 377 1.9e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151006
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T A 11: 106,005,253 M675K probably benign Het
Ccdc186 A T 19: 56,813,181 I168N probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep83 A G 10: 94,737,906 E219G probably damaging Het
Ctsj T C 13: 61,004,025 T73A possibly damaging Het
Ddr2 T A 1: 170,001,837 T283S probably benign Het
Ehbp1 T A 11: 22,095,370 D768V possibly damaging Het
Evpl T C 11: 116,221,365 D1833G probably damaging Het
Exoc1 A G 5: 76,537,702 N87S probably benign Het
Fam98b A C 2: 117,270,651 I315L possibly damaging Het
Fancg A G 4: 43,006,564 V330A probably damaging Het
Fbxo30 G A 10: 11,291,102 V523I possibly damaging Het
Fbxw27 A G 9: 109,770,093 C419R probably damaging Het
Flt3 C A 5: 147,375,649 V161L probably benign Het
Fndc7 G A 3: 108,883,449 T87I probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm6457 A T 18: 14,570,441 noncoding transcript Het
Gm7075 A G 10: 63,421,679 S21P probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
H2-M10.2 C A 17: 36,285,579 V125L probably benign Het
Hrh4 C T 18: 13,021,997 Q198* probably null Het
Lrch4 A G 5: 137,637,906 E373G probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Noa1 A C 5: 77,304,195 D547E probably damaging Het
Nr2e1 G A 10: 42,572,784 R153W probably damaging Het
Nudt9 A C 5: 104,050,621 M1L possibly damaging Het
Odf2 T A 2: 29,912,571 D282E probably benign Het
Olfr522 T A 7: 140,162,113 Y279F probably damaging Het
Olfr539 C A 7: 140,667,792 H168Q probably benign Het
Olfr908 A T 9: 38,516,158 N42I probably damaging Het
Osbpl5 C G 7: 143,691,928 A816P probably damaging Het
Pan2 T C 10: 128,317,634 I924T possibly damaging Het
Ppat A G 5: 76,928,422 probably benign Het
Rad50 T G 11: 53,692,863 I364L probably benign Het
Robo2 A G 16: 73,973,785 I484T possibly damaging Het
Ryr2 A T 13: 11,690,363 M2839K probably damaging Het
Sin3b A G 8: 72,750,526 D807G probably damaging Het
Sirpb1a G A 3: 15,411,443 T98I possibly damaging Het
Smim17 G A 7: 6,429,322 V88M probably damaging Het
Spib T C 7: 44,528,081 T229A probably damaging Het
St14 A T 9: 31,096,978 probably null Het
Syne4 A T 7: 30,318,976 Y381F probably damaging Het
Sytl1 T C 4: 133,261,071 probably benign Het
Tnpo3 A C 6: 29,602,013 probably benign Het
Trim12a T A 7: 104,304,206 I233F probably damaging Het
Tspan1 T A 4: 116,164,339 N82Y probably damaging Het
Vmn1r60 T A 7: 5,544,202 M300L probably benign Het
Wdr17 G A 8: 54,659,681 A788V possibly damaging Het
Wwtr1 A T 3: 57,575,237 V63E probably benign Het
Ylpm1 A G 12: 85,013,961 probably benign Het
Zfp956 T C 6: 47,951,078 probably benign Het
Other mutations in Gpr63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Gpr63 APN 4 25008445 missense possibly damaging 0.78
IGL01673:Gpr63 APN 4 25008014 missense probably benign 0.04
IGL01861:Gpr63 APN 4 25008545 missense probably damaging 0.98
IGL02082:Gpr63 APN 4 25008564 utr 3 prime probably benign
R0003:Gpr63 UTSW 4 25007651 missense probably damaging 1.00
R0554:Gpr63 UTSW 4 25007447 missense probably benign
R0729:Gpr63 UTSW 4 25007480 missense probably benign 0.02
R1506:Gpr63 UTSW 4 25008227 missense probably damaging 1.00
R3103:Gpr63 UTSW 4 25007353 missense probably benign 0.00
R3694:Gpr63 UTSW 4 25007993 missense probably damaging 1.00
R4021:Gpr63 UTSW 4 25008470 missense possibly damaging 0.77
R4807:Gpr63 UTSW 4 25007446 missense probably benign
R4967:Gpr63 UTSW 4 25008368 nonsense probably null
R5047:Gpr63 UTSW 4 25008202 missense probably benign 0.44
R5382:Gpr63 UTSW 4 25007952 missense probably benign
R7047:Gpr63 UTSW 4 25007320 missense probably benign 0.00
R7216:Gpr63 UTSW 4 25008038 missense probably damaging 1.00
R8317:Gpr63 UTSW 4 25008223 missense probably damaging 1.00
R8387:Gpr63 UTSW 4 25008301 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CTGCGCTTATTTTCAGGCAAAAG -3'
(R):5'- AAAACTGCTGGTGCTGGAGTC -3'

Sequencing Primer
(F):5'- GCGCTTATTTTCAGGCAAAAGGATTC -3'
(R):5'- TGTTCACTGCCAAGGAGCTAAATC -3'
Posted On2016-08-04