Incidental Mutation 'R5325:Nudt9'
ID421882
Institutional Source Beutler Lab
Gene Symbol Nudt9
Ensembl Gene ENSMUSG00000029310
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 9
Synonyms1190002C07Rik
MMRRC Submission 042908-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R5325 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location104046306-104065379 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to C at 104050621 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000117181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031250] [ENSMUST00000128511] [ENSMUST00000134313] [ENSMUST00000148261] [ENSMUST00000150226]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031250
AA Change: M51L

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031250
Gene: ENSMUSG00000029310
AA Change: M51L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
Pfam:NUDIX 189 334 1.2e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128511
AA Change: M1L

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119820
Gene: ENSMUSG00000029310
AA Change: M1L

DomainStartEndE-ValueType
PDB:1QVJ|A 9 158 1e-89 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000134313
AA Change: M1L

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117181
Gene: ENSMUSG00000029310
AA Change: M1L

DomainStartEndE-ValueType
PDB:1QVJ|A 9 152 2e-84 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142018
Predicted Effect possibly damaging
Transcript: ENSMUST00000148261
AA Change: M1L

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115170
Gene: ENSMUSG00000029310
AA Change: M1L

DomainStartEndE-ValueType
PDB:1QVJ|A 9 110 2e-68 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000150226
AA Change: M1L

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114631
Gene: ENSMUSG00000029310
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 102 116 N/A INTRINSIC
Pfam:NUDIX 131 207 6.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176065
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196765
Meta Mutation Damage Score 0.1872 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Nudix hydrolase family. Nudix boxes are found in a family of diverse enzymes that catalyze the hydrolysis of nucleoside diphosphate derivatives. This enzyme is an ADP-ribose pyrophosphatase that catalyzes the hydrolysis of ADP-ribose to AMP and ribose-5-P. It requires divalent metal ions and an intact Nudix motif for enzymatic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T A 11: 106,005,253 M675K probably benign Het
Ccdc186 A T 19: 56,813,181 I168N probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep83 A G 10: 94,737,906 E219G probably damaging Het
Ctsj T C 13: 61,004,025 T73A possibly damaging Het
Ddr2 T A 1: 170,001,837 T283S probably benign Het
Ehbp1 T A 11: 22,095,370 D768V possibly damaging Het
Evpl T C 11: 116,221,365 D1833G probably damaging Het
Exoc1 A G 5: 76,537,702 N87S probably benign Het
Fam98b A C 2: 117,270,651 I315L possibly damaging Het
Fancg A G 4: 43,006,564 V330A probably damaging Het
Fbxo30 G A 10: 11,291,102 V523I possibly damaging Het
Fbxw27 A G 9: 109,770,093 C419R probably damaging Het
Flt3 C A 5: 147,375,649 V161L probably benign Het
Fndc7 G A 3: 108,883,449 T87I probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm6457 A T 18: 14,570,441 noncoding transcript Het
Gm7075 A G 10: 63,421,679 S21P probably benign Het
Gpr63 T C 4: 25,007,294 V6A probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
H2-M10.2 C A 17: 36,285,579 V125L probably benign Het
Hrh4 C T 18: 13,021,997 Q198* probably null Het
Lrch4 A G 5: 137,637,906 E373G probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Noa1 A C 5: 77,304,195 D547E probably damaging Het
Nr2e1 G A 10: 42,572,784 R153W probably damaging Het
Odf2 T A 2: 29,912,571 D282E probably benign Het
Olfr522 T A 7: 140,162,113 Y279F probably damaging Het
Olfr539 C A 7: 140,667,792 H168Q probably benign Het
Olfr908 A T 9: 38,516,158 N42I probably damaging Het
Osbpl5 C G 7: 143,691,928 A816P probably damaging Het
Pan2 T C 10: 128,317,634 I924T possibly damaging Het
Ppat A G 5: 76,928,422 probably benign Het
Rad50 T G 11: 53,692,863 I364L probably benign Het
Robo2 A G 16: 73,973,785 I484T possibly damaging Het
Ryr2 A T 13: 11,690,363 M2839K probably damaging Het
Sin3b A G 8: 72,750,526 D807G probably damaging Het
Sirpb1a G A 3: 15,411,443 T98I possibly damaging Het
Smim17 G A 7: 6,429,322 V88M probably damaging Het
Spib T C 7: 44,528,081 T229A probably damaging Het
St14 A T 9: 31,096,978 probably null Het
Syne4 A T 7: 30,318,976 Y381F probably damaging Het
Sytl1 T C 4: 133,261,071 probably benign Het
Tnpo3 A C 6: 29,602,013 probably benign Het
Trim12a T A 7: 104,304,206 I233F probably damaging Het
Tspan1 T A 4: 116,164,339 N82Y probably damaging Het
Vmn1r60 T A 7: 5,544,202 M300L probably benign Het
Wdr17 G A 8: 54,659,681 A788V possibly damaging Het
Wwtr1 A T 3: 57,575,237 V63E probably benign Het
Ylpm1 A G 12: 85,013,961 probably benign Het
Zfp956 T C 6: 47,951,078 probably benign Het
Other mutations in Nudt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Nudt9 APN 5 104061762 unclassified probably benign
IGL01398:Nudt9 APN 5 104065113 makesense probably null
IGL01910:Nudt9 APN 5 104054309 missense probably damaging 0.96
IGL02441:Nudt9 APN 5 104065019 missense probably benign 0.01
IGL03207:Nudt9 APN 5 104058226 splice site probably benign
steady UTSW 5 104058111 missense probably damaging 1.00
streak UTSW 5 104050621 start codon destroyed possibly damaging 0.89
struck UTSW 5 104065038 nonsense probably null
R0136:Nudt9 UTSW 5 104047106 missense probably benign
R0227:Nudt9 UTSW 5 104061675 missense possibly damaging 0.90
R0652:Nudt9 UTSW 5 104050601 missense possibly damaging 0.48
R0755:Nudt9 UTSW 5 104065054 missense probably damaging 0.98
R1156:Nudt9 UTSW 5 104050730 nonsense probably null
R1462:Nudt9 UTSW 5 104065038 nonsense probably null
R1462:Nudt9 UTSW 5 104065038 nonsense probably null
R1962:Nudt9 UTSW 5 104065105 missense probably benign
R2697:Nudt9 UTSW 5 104064993 missense probably damaging 1.00
R2916:Nudt9 UTSW 5 104055558 missense probably damaging 1.00
R3780:Nudt9 UTSW 5 104047106 missense probably benign
R3972:Nudt9 UTSW 5 104047125 missense probably benign 0.00
R4354:Nudt9 UTSW 5 104058111 missense probably damaging 1.00
R5652:Nudt9 UTSW 5 104059780 missense probably benign 0.19
R6087:Nudt9 UTSW 5 104050813 missense probably benign 0.00
R6240:Nudt9 UTSW 5 104047089 missense probably benign 0.31
R6241:Nudt9 UTSW 5 104054285 missense probably damaging 0.98
R6280:Nudt9 UTSW 5 104065069 missense probably benign
R6719:Nudt9 UTSW 5 104061696 missense probably damaging 1.00
R6865:Nudt9 UTSW 5 104059679 missense probably damaging 1.00
R7225:Nudt9 UTSW 5 104065100 missense probably benign
R7629:Nudt9 UTSW 5 104050694 missense possibly damaging 0.90
R7685:Nudt9 UTSW 5 104047080 nonsense probably null
X0063:Nudt9 UTSW 5 104050694 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAGGGTTTTGAGAGTCTC -3'
(R):5'- TCTGCTCACCTGATCTGAGG -3'

Sequencing Primer
(F):5'- AACAGCTTGCCTTAGAGGTC -3'
(R):5'- TCACCTGATCTGAGGGTCCG -3'
Posted On2016-08-04