Incidental Mutation 'R5325:Nr2e1'
ID421900
Institutional Source Beutler Lab
Gene Symbol Nr2e1
Ensembl Gene ENSMUSG00000019803
Gene Namenuclear receptor subfamily 2, group E, member 1
SynonymsMtll, Tlx, tailless, Nr2e1
MMRRC Submission 042908-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock #R5325 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location42561963-42583632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42572784 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 153 (R153W)
Ref Sequence ENSEMBL: ENSMUSP00000019938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019938] [ENSMUST00000105498]
Predicted Effect probably damaging
Transcript: ENSMUST00000019938
AA Change: R153W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019938
Gene: ENSMUSG00000019803
AA Change: R153W

DomainStartEndE-ValueType
ZnF_C4 13 86 2.04e-36 SMART
HOLI 187 354 1.42e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105498
SMART Domains Protein: ENSMUSP00000101137
Gene: ENSMUSG00000019803

DomainStartEndE-ValueType
HOLI 3 142 2.56e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126848
SMART Domains Protein: ENSMUSP00000116439
Gene: ENSMUSG00000019803

DomainStartEndE-ValueType
ZnF_C4 9 82 2.04e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143891
Meta Mutation Damage Score 0.2860 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an orphan receptor involved in retinal development. The encoded protein also regulates adult neural stem cell proliferation and may be involved in control of aggressive behavior. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes have small brains, hypoplasia of cerebrum and olfactory lobes, thin optic layers, reduced retinal vessels and hydrocephaly on some genetic backgrounds. Mutants do poorly in sensorimotor tests, are aggressive and females lack maternal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T A 11: 106,005,253 M675K probably benign Het
Ccdc186 A T 19: 56,813,181 I168N probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep83 A G 10: 94,737,906 E219G probably damaging Het
Ctsj T C 13: 61,004,025 T73A possibly damaging Het
Ddr2 T A 1: 170,001,837 T283S probably benign Het
Ehbp1 T A 11: 22,095,370 D768V possibly damaging Het
Evpl T C 11: 116,221,365 D1833G probably damaging Het
Exoc1 A G 5: 76,537,702 N87S probably benign Het
Fam98b A C 2: 117,270,651 I315L possibly damaging Het
Fancg A G 4: 43,006,564 V330A probably damaging Het
Fbxo30 G A 10: 11,291,102 V523I possibly damaging Het
Fbxw27 A G 9: 109,770,093 C419R probably damaging Het
Flt3 C A 5: 147,375,649 V161L probably benign Het
Fndc7 G A 3: 108,883,449 T87I probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm6457 A T 18: 14,570,441 noncoding transcript Het
Gm7075 A G 10: 63,421,679 S21P probably benign Het
Gpr63 T C 4: 25,007,294 V6A probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
H2-M10.2 C A 17: 36,285,579 V125L probably benign Het
Hrh4 C T 18: 13,021,997 Q198* probably null Het
Lrch4 A G 5: 137,637,906 E373G probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Noa1 A C 5: 77,304,195 D547E probably damaging Het
Nudt9 A C 5: 104,050,621 M1L possibly damaging Het
Odf2 T A 2: 29,912,571 D282E probably benign Het
Olfr522 T A 7: 140,162,113 Y279F probably damaging Het
Olfr539 C A 7: 140,667,792 H168Q probably benign Het
Olfr908 A T 9: 38,516,158 N42I probably damaging Het
Osbpl5 C G 7: 143,691,928 A816P probably damaging Het
Pan2 T C 10: 128,317,634 I924T possibly damaging Het
Ppat A G 5: 76,928,422 probably benign Het
Rad50 T G 11: 53,692,863 I364L probably benign Het
Robo2 A G 16: 73,973,785 I484T possibly damaging Het
Ryr2 A T 13: 11,690,363 M2839K probably damaging Het
Sin3b A G 8: 72,750,526 D807G probably damaging Het
Sirpb1a G A 3: 15,411,443 T98I possibly damaging Het
Smim17 G A 7: 6,429,322 V88M probably damaging Het
Spib T C 7: 44,528,081 T229A probably damaging Het
St14 A T 9: 31,096,978 probably null Het
Syne4 A T 7: 30,318,976 Y381F probably damaging Het
Sytl1 T C 4: 133,261,071 probably benign Het
Tnpo3 A C 6: 29,602,013 probably benign Het
Trim12a T A 7: 104,304,206 I233F probably damaging Het
Tspan1 T A 4: 116,164,339 N82Y probably damaging Het
Vmn1r60 T A 7: 5,544,202 M300L probably benign Het
Wdr17 G A 8: 54,659,681 A788V possibly damaging Het
Wwtr1 A T 3: 57,575,237 V63E probably benign Het
Ylpm1 A G 12: 85,013,961 probably benign Het
Zfp956 T C 6: 47,951,078 probably benign Het
Other mutations in Nr2e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Nr2e1 APN 10 42568453 missense probably damaging 1.00
IGL01936:Nr2e1 APN 10 42567973 missense possibly damaging 0.90
IGL02272:Nr2e1 APN 10 42567979 missense probably damaging 1.00
IGL03092:Nr2e1 APN 10 42571482 missense probably damaging 1.00
IGL03405:Nr2e1 APN 10 42568381 missense probably damaging 1.00
Dubious UTSW 10 42571487 nonsense probably null
BB010:Nr2e1 UTSW 10 42563383 missense probably damaging 1.00
BB020:Nr2e1 UTSW 10 42563383 missense probably damaging 1.00
R1581:Nr2e1 UTSW 10 42567968 missense probably benign 0.12
R1807:Nr2e1 UTSW 10 42582909 splice site probably null
R1879:Nr2e1 UTSW 10 42568371 critical splice donor site probably null
R1944:Nr2e1 UTSW 10 42572778 missense probably benign
R2426:Nr2e1 UTSW 10 42563485 missense probably damaging 1.00
R2842:Nr2e1 UTSW 10 42568445 missense probably damaging 0.99
R4515:Nr2e1 UTSW 10 42578191 missense probably benign
R5305:Nr2e1 UTSW 10 42571487 nonsense probably null
R5316:Nr2e1 UTSW 10 42571491 missense probably benign 0.10
R5908:Nr2e1 UTSW 10 42572769 missense probably benign
R7040:Nr2e1 UTSW 10 42568378 missense probably damaging 0.99
R7593:Nr2e1 UTSW 10 42563479 missense probably damaging 1.00
R7765:Nr2e1 UTSW 10 42574437 missense probably benign 0.32
R7933:Nr2e1 UTSW 10 42563383 missense probably damaging 1.00
R8158:Nr2e1 UTSW 10 42582885 missense probably benign 0.00
R8342:Nr2e1 UTSW 10 42568429 missense probably damaging 1.00
Z1177:Nr2e1 UTSW 10 42568427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTTTGGCTCAACAGAAGGAG -3'
(R):5'- TTGTCTCTGTAGCCGTGCAG -3'

Sequencing Primer
(F):5'- CTCAACAGAAGGAGCAAGAGACTC -3'
(R):5'- GGGTCCTCGGACGTCCAC -3'
Posted On2016-08-04