Incidental Mutation 'R0485:Clec4a2'
ID42199
Institutional Source Beutler Lab
Gene Symbol Clec4a2
Ensembl Gene ENSMUSG00000030148
Gene NameC-type lectin domain family 4, member a2
SynonymsDcir1, dendritic cell immunoreceptor, DCIR, Clecsf6
MMRRC Submission 038684-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R0485 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location123106428-123143999 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123123629 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 14 (N14K)
Ref Sequence ENSEMBL: ENSMUSP00000032248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032248] [ENSMUST00000041779] [ENSMUST00000159891] [ENSMUST00000161365] [ENSMUST00000161636]
Predicted Effect probably damaging
Transcript: ENSMUST00000032248
AA Change: N14K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032248
Gene: ENSMUSG00000030148
AA Change: N14K

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
CLECT 131 256 1.18e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000041779
AA Change: N14K

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045781
Gene: ENSMUSG00000030148
AA Change: N14K

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
CLECT 107 232 1.18e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159891
AA Change: N14K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000161365
AA Change: N14K

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124615
Gene: ENSMUSG00000030148
AA Change: N14K

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
CLECT 107 232 1.18e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161636
AA Change: N14K

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123973
Gene: ENSMUSG00000030148
AA Change: N14K

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
Meta Mutation Damage Score 0.2032 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may play a role in inflammatory and immune response. Multiple transcript variants encoding distinct isoforms have been identified for this gene. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased IgG2a, IgG2b and IgG3 levels, increased B cell proliferation, enlarged lymph nodes and degeneration of seminiferous tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik A G 16: 3,907,647 V5A probably damaging Het
Abi3bp A G 16: 56,604,012 probably null Het
Acot11 G A 4: 106,762,027 R184C probably damaging Het
Adgre5 A T 8: 83,731,998 I133N probably damaging Het
Afap1 A T 5: 35,951,003 Q231L probably damaging Het
Alg12 T C 15: 88,811,427 T289A probably benign Het
Ank3 T A 10: 69,882,544 S542T possibly damaging Het
Ankmy2 G A 12: 36,182,390 R138Q possibly damaging Het
Ascc2 C T 11: 4,672,302 A456V probably benign Het
Atg4c G A 4: 99,224,482 V289I probably benign Het
Bbs7 A T 3: 36,602,873 Y269N probably damaging Het
Bcas3 T A 11: 85,495,850 D370E probably damaging Het
Bicc1 T G 10: 70,925,315 E955A probably damaging Het
Bok T C 1: 93,689,277 F115S probably damaging Het
Caap1 A T 4: 94,550,521 probably null Het
Cacna2d3 T A 14: 29,534,519 M95L possibly damaging Het
Calcrl T A 2: 84,370,091 D115V probably benign Het
Car7 A T 8: 104,543,538 M57L probably benign Het
Casq1 G T 1: 172,210,390 probably benign Het
Cep290 A T 10: 100,549,344 D1894V possibly damaging Het
Col16a1 G T 4: 130,090,497 probably benign Het
Col5a1 T C 2: 27,990,097 probably benign Het
Col5a2 A T 1: 45,378,482 I1311N probably damaging Het
Col5a3 T C 9: 20,782,708 T1050A probably damaging Het
Colgalt2 A T 1: 152,484,871 I220F probably damaging Het
Cpb1 A T 3: 20,275,628 V8E unknown Het
Dchs1 C T 7: 105,772,727 R162H probably benign Het
Dhx37 A G 5: 125,422,231 Y638H probably benign Het
Dhx40 T G 11: 86,771,262 probably benign Het
Ehd2 T A 7: 15,952,076 Q357L probably benign Het
Ewsr1 T C 11: 5,070,737 probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gid8 T A 2: 180,713,211 Y3* probably null Het
Gm10212 A C 19: 11,570,810 noncoding transcript Het
Gm4763 C A 7: 24,722,745 C193F possibly damaging Het
Gm597 G T 1: 28,778,142 Q270K probably damaging Het
Gm960 A T 19: 4,658,414 I350N probably damaging Het
Grin3b T A 10: 79,974,056 N465K possibly damaging Het
Hist1h1d A T 13: 23,555,750 K221* probably null Het
Htr4 A T 18: 62,428,154 N162I probably damaging Het
Itga3 T C 11: 95,061,970 D325G probably benign Het
Itpr3 T G 17: 27,111,929 V1737G probably damaging Het
Kcnab2 C T 4: 152,394,982 V251I probably benign Het
Kcnn2 A T 18: 45,560,148 I264L probably benign Het
Klhl41 T C 2: 69,671,256 Y354H probably damaging Het
Klra6 T C 6: 130,023,638 I68V probably benign Het
Letm2 G T 8: 25,592,558 P178Q probably damaging Het
Lrmp T C 6: 145,165,212 C248R probably damaging Het
Mbtps1 A T 8: 119,522,601 probably benign Het
Mecom C T 3: 29,980,972 probably benign Het
Mrps5 T A 2: 127,591,825 S45T possibly damaging Het
Msra T A 14: 64,440,761 I29F possibly damaging Het
Mup5 T C 4: 61,832,992 probably null Het
Myo1a T C 10: 127,719,242 probably benign Het
Myrip C A 9: 120,441,377 N564K probably benign Het
Naa20 T A 2: 145,915,672 D148E probably damaging Het
Naga T G 15: 82,336,755 probably benign Het
Npc1 A G 18: 12,213,446 V231A probably benign Het
Nphs1 T C 7: 30,467,515 F716L probably benign Het
Olfr284 T C 15: 98,340,929 H20R probably benign Het
Parn G C 16: 13,654,435 probably benign Het
Polk A T 13: 96,483,764 C664S probably benign Het
Prkar2b A G 12: 31,976,035 probably benign Het
Prkdc A G 16: 15,833,740 E3747G probably damaging Het
Prmt5 A T 14: 54,511,255 M362K probably damaging Het
Prob1 T C 18: 35,653,825 T459A possibly damaging Het
Rttn C T 18: 89,090,419 probably benign Het
Scn1a T C 2: 66,273,925 M1664V probably damaging Het
Sez6 T A 11: 77,953,813 L154H probably damaging Het
Sh3tc1 A G 5: 35,702,012 probably benign Het
Shkbp1 C T 7: 27,348,581 G334D probably damaging Het
Slc8a1 A T 17: 81,647,993 F539I probably damaging Het
Sptan1 T C 2: 30,013,848 probably benign Het
Ssc5d C T 7: 4,937,471 T861M probably damaging Het
Tbx5 A T 5: 119,883,458 M510L probably benign Het
Tdp1 A G 12: 99,909,842 T351A probably benign Het
Tmc8 T A 11: 117,792,078 probably benign Het
Tmco5 T A 2: 116,890,107 D205E probably benign Het
Tmprss2 T C 16: 97,571,994 probably benign Het
Tph1 T A 7: 46,650,024 K364N probably benign Het
Trim24 T C 6: 37,957,066 L648P probably damaging Het
Trmt6 C A 2: 132,809,030 probably benign Het
Ube2i A T 17: 25,269,285 probably benign Het
Vcan A C 13: 89,704,660 L727R possibly damaging Het
Vmn2r28 T C 7: 5,488,690 Y186C probably damaging Het
Wars C A 12: 108,875,157 D232Y probably damaging Het
Xrcc5 T C 1: 72,338,945 probably benign Het
Zbtb24 T A 10: 41,464,536 S543T probably damaging Het
Zfp91 A G 19: 12,775,989 probably benign Het
Other mutations in Clec4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Clec4a2 APN 6 123139078 intron probably benign
IGL01384:Clec4a2 APN 6 123127988 missense probably damaging 1.00
IGL01481:Clec4a2 APN 6 123142500 missense probably benign 0.30
IGL02159:Clec4a2 APN 6 123139326 missense probably benign 0.04
IGL02436:Clec4a2 APN 6 123140678 missense possibly damaging 0.79
IGL03140:Clec4a2 APN 6 123140776 splice site probably benign
R1852:Clec4a2 UTSW 6 123139125 nonsense probably null
R3431:Clec4a2 UTSW 6 123139411 splice site probably null
R4436:Clec4a2 UTSW 6 123128054 critical splice donor site probably null
R4524:Clec4a2 UTSW 6 123125084 missense probably damaging 1.00
R4736:Clec4a2 UTSW 6 123140663 missense probably damaging 1.00
R4740:Clec4a2 UTSW 6 123140663 missense probably damaging 1.00
R4908:Clec4a2 UTSW 6 123142503 missense probably damaging 1.00
R6516:Clec4a2 UTSW 6 123139406 missense probably damaging 1.00
R7394:Clec4a2 UTSW 6 123139120 missense unknown
R7454:Clec4a2 UTSW 6 123142452 missense probably damaging 0.98
R7644:Clec4a2 UTSW 6 123125015 missense probably benign 0.10
R8053:Clec4a2 UTSW 6 123128039 missense probably benign 0.00
X0024:Clec4a2 UTSW 6 123139081 intron probably benign
X0025:Clec4a2 UTSW 6 123139355 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CTGTTCAGTCAAAATCATCGTTGTGCC -3'
(R):5'- CCAGTAAAATACCAGATGGGAGCACTC -3'

Sequencing Primer
(F):5'- CAACAGGGTTCTCTAATAGCATGG -3'
(R):5'- GATGGGAGCACTCAAAAAATCATTC -3'
Posted On2013-05-23