Mutagenetix > Incidental Mutation

Incidental Mutation 'R5327:Rp1'

422005

Institutional Source

Beutler Lab

Gene Symbol

Rp1

Ensembl Gene

ENSMUSG00000025900

Gene Name

retinitis pigmentosa 1 (human)

Synonyms

Dcdc3, mG145, Orp1, oxygen-regulated protein 1, Rp1h

MMRRC Submission

042910-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R5327 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3999557-4409241 bp(-) (GRCm38)

Type of Mutation

splice site (2550 bp from exon)

DNA Base Change (assembly)

T to C at 4349360 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146439 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027032] [ENSMUST00000194992] [ENSMUST00000208660]

AlphaFold

P56716

Predicted Effect

probably benign
Transcript: ENSMUST00000027032
AA Change: I510V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000027032
Gene: ENSMUSG00000025900
AA Change: I510V

Domain	Start	End	E-Value	Type
DCX	30	117	4.37e-39	SMART
low complexity region	120	133	N/A	INTRINSIC
DCX	152	236	7.17e-35	SMART
low complexity region	343	354	N/A	INTRINSIC
low complexity region	403	414	N/A	INTRINSIC
low complexity region	462	473	N/A	INTRINSIC
low complexity region	646	661	N/A	INTRINSIC
low complexity region	1113	1123	N/A	INTRINSIC
low complexity region	1396	1412	N/A	INTRINSIC
low complexity region	1434	1444	N/A	INTRINSIC
low complexity region	1648	1661	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000194992

SMART Domains

Protein: ENSMUSP00000142146
Gene: ENSMUSG00000025900

Domain	Start	End	E-Value	Type
DCX	40	127	4.37e-39	SMART
low complexity region	130	143	N/A	INTRINSIC
DCX	162	246	7.17e-35	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000208660

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208793

Meta Mutation Damage Score

0.0703

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (101/101)

MGI Phenotype

FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA986860	A	G	1: 130,741,003	S36G	probably damaging	Het
Aarsd1	T	C	11: 101,410,377	N280D	probably benign	Het
Abca2	T	A	2: 25,445,674	M2099K	probably damaging	Het
Abcb5	T	A	12: 118,911,543	E631D	probably benign	Het
Acss2	T	A	2: 155,573,229	L682Q	probably null	Het
Adamts14	G	A	10: 61,198,488	P1207L	probably benign	Het
Adora1	G	A	1: 134,203,010	R308*	probably null	Het
Arcn1	A	T	9: 44,757,147	V264E	probably benign	Het
B3galt1	G	A	2: 68,118,768	G276S	probably damaging	Het
Bms1	A	T	6: 118,405,218	M453K	possibly damaging	Het
Bnip3l	T	C	14: 66,987,731	Y218C	probably damaging	Het
Cacna2d2	A	G	9: 107,513,606	E379G	probably null	Het
Cacng6	G	A	7: 3,434,860	G235R	probably damaging	Het
Capn8	A	T	1: 182,628,604	T640S	probably benign	Het
Ccdc106	T	C	7: 5,060,160		probably benign	Het
Ccdc33	A	T	9: 58,086,577	N95K	probably benign	Het
Celsr3	T	A	9: 108,842,708		probably benign	Het
Cemip	A	T	7: 83,955,301	N844K	probably damaging	Het
Chrdl2	A	T	7: 100,028,741	T284S	probably damaging	Het
Ckm	A	G	7: 19,420,165	Y279C	probably damaging	Het
Clvs1	A	T	4: 9,424,261	I236F	probably damaging	Het
Col9a1	T	C	1: 24,195,539		probably null	Het
Csmd1	T	C	8: 17,216,712	E66G	possibly damaging	Het
Ctdsp2	A	G	10: 126,996,054	D26G	probably damaging	Het
Ctsll3	C	A	13: 60,798,907		probably null	Het
Cyp2d12	A	T	15: 82,555,222	M26L	probably benign	Het
Cyp8b1	C	T	9: 121,914,884	D461N	probably damaging	Het
Dbt	A	T	3: 116,528,571		probably benign	Het
Dnah7c	A	G	1: 46,665,568	D2247G	probably benign	Het
Dsg1c	A	G	18: 20,267,937	I166V	possibly damaging	Het
Duoxa1	T	A	2: 122,303,880	E252D	probably damaging	Het
Ezr	T	A	17: 6,753,049	K211M	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fahd2a	T	C	2: 127,441,958	D54G	possibly damaging	Het
Fbxo9	A	T	9: 78,095,864		probably null	Het
Fndc1	A	G	17: 7,772,708	S719P	unknown	Het
Gas7	G	T	11: 67,662,090	G159C	probably damaging	Het
Gba2	T	C	4: 43,574,063	D130G	probably damaging	Het
Gli3	T	G	13: 15,548,507	S78A	probably damaging	Het
Gtpbp6	A	G	5: 110,106,904	F101S	probably damaging	Het
Gzme	G	A	14: 56,117,767	H236Y	probably benign	Het
Hira	T	C	16: 18,954,758	Y943H	probably damaging	Het
Hmbox1	G	A	14: 64,896,695	S152L	possibly damaging	Het
Ibtk	A	G	9: 85,737,466		probably null	Het
Jade1	T	C	3: 41,613,978	I827T	possibly damaging	Het
Jakmip3	A	T	7: 139,025,435	E389D	possibly damaging	Het
Klhdc8b	A	T	9: 108,449,042		probably benign	Het
Lama2	T	C	10: 27,138,946	T1589A	probably benign	Het
Lbx2	A	C	6: 83,087,803	K107T	probably damaging	Het
Ldha	A	G	7: 46,854,098	M259V	probably benign	Het
Lrrtm4	A	G	6: 80,022,637	K344R	probably damaging	Het
Ltb	A	T	17: 35,195,959	E245V	probably damaging	Het
Macf1	GCCCCC	GCCCCCC	4: 123,350,991		probably null	Het
Map3k13	T	A	16: 21,921,647	S575T	possibly damaging	Het
Mcpt2	A	T	14: 56,043,376	I74F	probably damaging	Het
Mpeg1	T	A	19: 12,461,649	V157D	probably damaging	Het
Mrpl21	A	T	19: 3,287,009		probably null	Het
Nagpa	T	C	16: 5,200,013	T99A	possibly damaging	Het
Nphs1	A	T	7: 30,463,825	I469F	probably benign	Het
Nyap2	A	G	1: 81,192,041	E171G	possibly damaging	Het
Oas1e	A	G	5: 120,791,941	Y171H	probably damaging	Het
Olfr1129	T	A	2: 87,575,699	V205D	probably damaging	Het
Olfr1392	T	C	11: 49,293,666	L115P	probably damaging	Het
Olfr196	T	C	16: 59,167,620	I174M	possibly damaging	Het
Olfr205	T	C	16: 59,329,098	K137R	probably benign	Het
Otud7b	C	A	3: 96,155,738	Q765K	probably benign	Het
Pdzd7	A	G	19: 45,028,777	V851A	probably benign	Het
Pi4ka	T	G	16: 17,325,413	K794T	probably damaging	Het
Pkhd1l1	T	A	15: 44,546,862	N2588K	probably damaging	Het
Pla2g6	A	T	15: 79,302,637	M471K	probably benign	Het
Plagl2	T	C	2: 153,235,839	H74R	possibly damaging	Het
Prf1	T	A	10: 61,300,258	N104K	probably benign	Het
Ptprf	A	T	4: 118,236,389	I358N	probably damaging	Het
Rcsd1	A	G	1: 165,655,303		probably null	Het
Rev1	G	A	1: 38,108,451	R3*	probably null	Het
Rrp12	G	A	19: 41,892,596	T132I	probably damaging	Het
Sema3a	T	C	5: 13,599,389	V702A	probably benign	Het
Serpinb12	A	G	1: 106,956,444	N307D	probably damaging	Het
Slc35d1	A	G	4: 103,213,186	L103P	probably damaging	Het
Smyd4	T	C	11: 75,390,939	C413R	probably damaging	Het
Stab1	G	A	14: 31,161,836	Q255*	probably null	Het
Synpo	T	A	18: 60,603,846	I343F	possibly damaging	Het
Tcirg1	A	G	19: 3,902,342		probably null	Het
Tmem132c	A	G	5: 127,563,752	T996A	possibly damaging	Het
Trim10	A	G	17: 36,870,189	E104G	probably damaging	Het
Trpc1	T	C	9: 95,721,471		probably null	Het
Tspo2	A	T	17: 48,449,859		probably benign	Het
Ugt2a3	A	T	5: 87,331,315	I258N	probably damaging	Het
Usp34	T	C	11: 23,468,846	L2998P	probably damaging	Het
Vmn1r45	A	C	6: 89,933,141	D162E	possibly damaging	Het
Vmn2r117	A	T	17: 23,477,874	Y186*	probably null	Het
Vmn2r67	A	G	7: 85,136,490	F769S	probably damaging	Het
Zbtb17	A	G	4: 141,465,631	I514V	probably benign	Het
Zfp329	A	C	7: 12,811,494	D34E	probably benign	Het

Other mutations in Rp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Rp1	APN	1	4346746	missense	probably damaging	0.98
IGL00593:Rp1	APN	1	4345403	missense	possibly damaging	0.70
IGL00956:Rp1	APN	1	4352212	missense	probably damaging	1.00
IGL01070:Rp1	APN	1	4345238	missense	probably damaging	1.00
IGL01531:Rp1	APN	1	4348945	missense	probably benign	0.00
IGL01668:Rp1	APN	1	4345718	missense	probably damaging	1.00
IGL01907:Rp1	APN	1	4348507	missense	possibly damaging	0.56
IGL02055:Rp1	APN	1	4352522	missense	probably damaging	1.00
IGL02071:Rp1	APN	1	4345310	missense	possibly damaging	0.46
IGL02128:Rp1	APN	1	4347385	missense	probably damaging	0.99
IGL02244:Rp1	APN	1	4348780	missense	probably benign	0.00
IGL02381:Rp1	APN	1	4352390	missense	probably benign	0.01
IGL02499:Rp1	APN	1	4349048	missense	probably benign	0.17
IGL02619:Rp1	APN	1	4348450	missense	possibly damaging	0.73
IGL02832:Rp1	APN	1	4349713	missense	probably benign	0.03
IGL02861:Rp1	APN	1	4346152	nonsense	probably null
IGL03288:Rp1	APN	1	4349524	missense	possibly damaging	0.88
IGL03290:Rp1	APN	1	4350041	missense	probably damaging	1.00
IGL03303:Rp1	APN	1	4344817	missense	probably damaging	1.00
R0041:Rp1	UTSW	1	4344628	missense	probably benign	0.36
R0111:Rp1	UTSW	1	4344760	missense	probably damaging	1.00
R0363:Rp1	UTSW	1	4347718	missense	probably damaging	1.00
R0440:Rp1	UTSW	1	4345640	missense	probably damaging	1.00
R0442:Rp1	UTSW	1	4346747	missense	probably benign	0.09
R0528:Rp1	UTSW	1	4344865	missense	possibly damaging	0.82
R0586:Rp1	UTSW	1	4347837	missense	possibly damaging	0.76
R0639:Rp1	UTSW	1	4346498	missense	probably benign	0.00
R0856:Rp1	UTSW	1	4344655	missense	probably benign	0.05
R0908:Rp1	UTSW	1	4344655	missense	probably benign	0.05
R0968:Rp1	UTSW	1	4345352	missense	probably benign	0.00
R1099:Rp1	UTSW	1	4352290	missense	possibly damaging	0.45
R1242:Rp1	UTSW	1	4344962	missense	probably benign	0.03
R1301:Rp1	UTSW	1	4345936	missense	possibly damaging	0.56
R1327:Rp1	UTSW	1	4347970	missense	probably benign	0.01
R1403:Rp1	UTSW	1	4346297	missense	possibly damaging	0.73
R1403:Rp1	UTSW	1	4346297	missense	possibly damaging	0.73
R1406:Rp1	UTSW	1	4351921	missense	possibly damaging	0.88
R1406:Rp1	UTSW	1	4351921	missense	possibly damaging	0.88
R1440:Rp1	UTSW	1	4347396	missense	probably damaging	1.00
R1509:Rp1	UTSW	1	4347694	missense	probably damaging	0.98
R1509:Rp1	UTSW	1	4348537	missense	probably benign	0.20
R1538:Rp1	UTSW	1	4345676	missense	probably damaging	1.00
R1609:Rp1	UTSW	1	4349201	missense	probably damaging	1.00
R1666:Rp1	UTSW	1	4349863	missense	probably damaging	1.00
R1703:Rp1	UTSW	1	4345169	missense	probably damaging	1.00
R1782:Rp1	UTSW	1	4349089	missense	probably benign	0.00
R1799:Rp1	UTSW	1	4348832	missense	possibly damaging	0.94
R1848:Rp1	UTSW	1	4347232	missense	possibly damaging	0.76
R1908:Rp1	UTSW	1	4348720	missense	probably damaging	0.99
R1919:Rp1	UTSW	1	4352671	missense	probably damaging	0.99
R2087:Rp1	UTSW	1	4348352	missense	probably damaging	1.00
R2211:Rp1	UTSW	1	4348139	missense	probably damaging	0.96
R2278:Rp1	UTSW	1	4348027	missense	possibly damaging	0.51
R2287:Rp1	UTSW	1	4345959	nonsense	probably null
R2316:Rp1	UTSW	1	4345640	missense	probably damaging	1.00
R2346:Rp1	UTSW	1	4348013	missense	probably damaging	1.00
R2878:Rp1	UTSW	1	4348139	missense	probably damaging	1.00
R3023:Rp1	UTSW	1	4352675	missense	probably damaging	1.00
R3025:Rp1	UTSW	1	4352675	missense	probably damaging	1.00
R3716:Rp1	UTSW	1	4349765	missense	probably benign	0.38
R3814:Rp1	UTSW	1	4349708	missense	probably benign
R3929:Rp1	UTSW	1	4352645	missense	probably damaging	1.00
R4064:Rp1	UTSW	1	4345400	missense	probably benign	0.08
R4426:Rp1	UTSW	1	4347924	missense	probably benign	0.13
R4557:Rp1	UTSW	1	4344663	missense	possibly damaging	0.61
R4764:Rp1	UTSW	1	4345878	missense	probably damaging	0.96
R4845:Rp1	UTSW	1	4349228	missense	probably benign	0.02
R4850:Rp1	UTSW	1	4348675	missense	probably damaging	1.00
R4857:Rp1	UTSW	1	4352316	missense	probably damaging	0.99
R4857:Rp1	UTSW	1	4352317	missense	probably damaging	1.00
R5159:Rp1	UTSW	1	4346203	missense	possibly damaging	0.73
R5226:Rp1	UTSW	1	4348033	missense	probably benign	0.01
R5352:Rp1	UTSW	1	4347098	missense	probably benign	0.00
R5504:Rp1	UTSW	1	4349890	missense	probably damaging	1.00
R5527:Rp1	UTSW	1	4346393	missense	possibly damaging	0.75
R5529:Rp1	UTSW	1	4345832	missense	probably benign	0.42
R5569:Rp1	UTSW	1	4345237	missense	probably damaging	1.00
R5622:Rp1	UTSW	1	4347837	missense	possibly damaging	0.76
R5970:Rp1	UTSW	1	4348462	missense	probably benign	0.05
R5992:Rp1	UTSW	1	4148703	missense	unknown
R6004:Rp1	UTSW	1	4197585	missense	unknown
R6018:Rp1	UTSW	1	4352836	missense	possibly damaging	0.83
R6074:Rp1	UTSW	1	4345379	missense	probably benign	0.02
R6127:Rp1	UTSW	1	4349311	missense	possibly damaging	0.80
R6187:Rp1	UTSW	1	4349869	missense	probably damaging	1.00
R6301:Rp1	UTSW	1	4347254	missense	probably benign	0.04
R6317:Rp1	UTSW	1	4041989	missense	unknown
R6405:Rp1	UTSW	1	4345771	missense	probably damaging	1.00
R6445:Rp1	UTSW	1	4226617	missense	unknown
R6466:Rp1	UTSW	1	4347886	missense	probably benign	0.01
R6501:Rp1	UTSW	1	4311280	intron	probably benign
R6547:Rp1	UTSW	1	4170305	missense	unknown
R6604:Rp1	UTSW	1	4019128	missense	unknown
R6700:Rp1	UTSW	1	4349896	missense	probably damaging	1.00
R6706:Rp1	UTSW	1	4142664	missense	unknown
R6831:Rp1	UTSW	1	4349864	splice site	probably null
R6918:Rp1	UTSW	1	3999608	missense	unknown
R6973:Rp1	UTSW	1	4351994	nonsense	probably null
R6981:Rp1	UTSW	1	4345655	missense	probably benign	0.06
R7009:Rp1	UTSW	1	4042068	missense	unknown
R7078:Rp1	UTSW	1	4206791	missense	unknown
R7112:Rp1	UTSW	1	4349018	missense	probably benign	0.43
R7135:Rp1	UTSW	1	4348168	missense	possibly damaging	0.83
R7165:Rp1	UTSW	1	4349917	missense	probably damaging	0.99
R7199:Rp1	UTSW	1	4347290	missense	possibly damaging	0.73
R7232:Rp1	UTSW	1	4228601	missense	unknown
R7367:Rp1	UTSW	1	4347998	missense	probably benign	0.42
R7484:Rp1	UTSW	1	4345481	missense	probably benign	0.10
R7500:Rp1	UTSW	1	4311278	missense	unknown
R7569:Rp1	UTSW	1	4284840	missense	unknown
R7642:Rp1	UTSW	1	4147831	missense	unknown
R7693:Rp1	UTSW	1	4347403	missense	probably damaging	1.00
R7742:Rp1	UTSW	1	4170234	missense	unknown
R7759:Rp1	UTSW	1	4344884	missense	probably benign
R7784:Rp1	UTSW	1	4142658	missense	unknown
R7816:Rp1	UTSW	1	4347703	missense	probably damaging	0.98
R7866:Rp1	UTSW	1	4347701	missense	probably benign	0.02
R8215:Rp1	UTSW	1	4245095	missense	unknown
R8281:Rp1	UTSW	1	4347916	missense	probably damaging	1.00
R8294:Rp1	UTSW	1	4345997	missense	probably benign	0.09
R8309:Rp1	UTSW	1	4347089	missense	probably benign	0.00
R8311:Rp1	UTSW	1	4348349	missense	probably benign	0.11
R8500:Rp1	UTSW	1	4346590	missense	possibly damaging	0.91
R8559:Rp1	UTSW	1	4349561	missense	probably damaging	1.00
R8672:Rp1	UTSW	1	4348784	missense	possibly damaging	0.55
R8688:Rp1	UTSW	1	4346405	missense	probably benign	0.01
R8792:Rp1	UTSW	1	4024868	missense	unknown
R8859:Rp1	UTSW	1	4349960	missense	probably benign	0.07
R8945:Rp1	UTSW	1	4349594	missense	probably benign	0.42
R8959:Rp1	UTSW	1	4349427	intron	probably benign
R8979:Rp1	UTSW	1	4148714	missense	unknown
R9126:Rp1	UTSW	1	4346913	missense	probably damaging	0.99
R9156:Rp1	UTSW	1	4163938	missense	unknown
R9160:Rp1	UTSW	1	4346497	missense	probably benign	0.00
R9221:Rp1	UTSW	1	4245043	missense	unknown
R9263:Rp1	UTSW	1	4348452	missense	probably benign	0.25
R9263:Rp1	UTSW	1	4348937	missense	probably benign	0.02
R9302:Rp1	UTSW	1	4346566	missense	probably damaging	1.00
R9318:Rp1	UTSW	1	4348265	missense	probably benign	0.09
R9414:Rp1	UTSW	1	4243618	missense	unknown
R9474:Rp1	UTSW	1	4092615	critical splice donor site	probably null
R9478:Rp1	UTSW	1	4347322	missense	probably benign	0.06
R9529:Rp1	UTSW	1	4346224	missense	probably benign
R9572:Rp1	UTSW	1	4348439	missense	probably benign
R9673:Rp1	UTSW	1	4267569	missense	unknown
R9709:Rp1	UTSW	1	4042032	missense	unknown
R9716:Rp1	UTSW	1	4142610	critical splice donor site	probably null
RF003:Rp1	UTSW	1	4344694	missense	probably damaging	0.99
V1662:Rp1	UTSW	1	4349560	missense	probably damaging	1.00
X0012:Rp1	UTSW	1	4347695	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CACGACTGAGTTCTCTGGTG -3'
(R):5'- TGGGAGAATGCCTCTATGGAG -3'

Sequencing Primer
(F):5'- TGCAGTTGACGGTAAAGCATTG -3'
(R):5'- CTCCTGGACCAAGGAGAATG -3'

Posted On

2016-08-04