Incidental Mutation 'R5327:Bms1'
ID422038
Institutional Source Beutler Lab
Gene Symbol Bms1
Ensembl Gene ENSMUSG00000030138
Gene NameBMS1, ribosome biogenesis factor
SynonymsBms1l
MMRRC Submission 042910-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5327 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location118383381-118419474 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118405218 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 453 (M453K)
Ref Sequence ENSEMBL: ENSMUSP00000032237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032237]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032237
AA Change: M453K

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032237
Gene: ENSMUSG00000030138
AA Change: M453K

DomainStartEndE-ValueType
SCOP:d1f5na2 78 187 2e-5 SMART
low complexity region 190 205 N/A INTRINSIC
AARP2CN 231 317 2.15e-42 SMART
low complexity region 436 460 N/A INTRINSIC
low complexity region 462 481 N/A INTRINSIC
low complexity region 498 514 N/A INTRINSIC
low complexity region 518 537 N/A INTRINSIC
low complexity region 590 613 N/A INTRINSIC
low complexity region 642 661 N/A INTRINSIC
Blast:AAA 663 740 9e-20 BLAST
DUF663 816 1108 6.7e-173 SMART
coiled coil region 1223 1257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205207
Meta Mutation Damage Score 0.0710 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a ribosome assembly protein. A similar protein in yeast functions in 35S-rRNA processing, which includes a series of cleavage steps critical for formation of 40S ribosomes. Related pseudogenes exist on chromosomes 2, 9, 10, 15, 16, and 22.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,741,003 S36G probably damaging Het
Aarsd1 T C 11: 101,410,377 N280D probably benign Het
Abca2 T A 2: 25,445,674 M2099K probably damaging Het
Abcb5 T A 12: 118,911,543 E631D probably benign Het
Acss2 T A 2: 155,573,229 L682Q probably null Het
Adamts14 G A 10: 61,198,488 P1207L probably benign Het
Adora1 G A 1: 134,203,010 R308* probably null Het
Arcn1 A T 9: 44,757,147 V264E probably benign Het
B3galt1 G A 2: 68,118,768 G276S probably damaging Het
Bnip3l T C 14: 66,987,731 Y218C probably damaging Het
Cacna2d2 A G 9: 107,513,606 E379G probably null Het
Cacng6 G A 7: 3,434,860 G235R probably damaging Het
Capn8 A T 1: 182,628,604 T640S probably benign Het
Ccdc106 T C 7: 5,060,160 probably benign Het
Ccdc33 A T 9: 58,086,577 N95K probably benign Het
Celsr3 T A 9: 108,842,708 probably benign Het
Cemip A T 7: 83,955,301 N844K probably damaging Het
Chrdl2 A T 7: 100,028,741 T284S probably damaging Het
Ckm A G 7: 19,420,165 Y279C probably damaging Het
Clvs1 A T 4: 9,424,261 I236F probably damaging Het
Col9a1 T C 1: 24,195,539 probably null Het
Csmd1 T C 8: 17,216,712 E66G possibly damaging Het
Ctdsp2 A G 10: 126,996,054 D26G probably damaging Het
Ctsll3 C A 13: 60,798,907 probably null Het
Cyp2d12 A T 15: 82,555,222 M26L probably benign Het
Cyp8b1 C T 9: 121,914,884 D461N probably damaging Het
Dbt A T 3: 116,528,571 probably benign Het
Dnah7c A G 1: 46,665,568 D2247G probably benign Het
Dsg1c A G 18: 20,267,937 I166V possibly damaging Het
Duoxa1 T A 2: 122,303,880 E252D probably damaging Het
Ezr T A 17: 6,753,049 K211M probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fahd2a T C 2: 127,441,958 D54G possibly damaging Het
Fbxo9 A T 9: 78,095,864 probably null Het
Fndc1 A G 17: 7,772,708 S719P unknown Het
Gas7 G T 11: 67,662,090 G159C probably damaging Het
Gba2 T C 4: 43,574,063 D130G probably damaging Het
Gli3 T G 13: 15,548,507 S78A probably damaging Het
Gtpbp6 A G 5: 110,106,904 F101S probably damaging Het
Gzme G A 14: 56,117,767 H236Y probably benign Het
Hira T C 16: 18,954,758 Y943H probably damaging Het
Hmbox1 G A 14: 64,896,695 S152L possibly damaging Het
Ibtk A G 9: 85,737,466 probably null Het
Jade1 T C 3: 41,613,978 I827T possibly damaging Het
Jakmip3 A T 7: 139,025,435 E389D possibly damaging Het
Klhdc8b A T 9: 108,449,042 probably benign Het
Lama2 T C 10: 27,138,946 T1589A probably benign Het
Lbx2 A C 6: 83,087,803 K107T probably damaging Het
Ldha A G 7: 46,854,098 M259V probably benign Het
Lrrtm4 A G 6: 80,022,637 K344R probably damaging Het
Ltb A T 17: 35,195,959 E245V probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,350,991 probably null Het
Map3k13 T A 16: 21,921,647 S575T possibly damaging Het
Mcpt2 A T 14: 56,043,376 I74F probably damaging Het
Mpeg1 T A 19: 12,461,649 V157D probably damaging Het
Mrpl21 A T 19: 3,287,009 probably null Het
Nagpa T C 16: 5,200,013 T99A possibly damaging Het
Nphs1 A T 7: 30,463,825 I469F probably benign Het
Nyap2 A G 1: 81,192,041 E171G possibly damaging Het
Oas1e A G 5: 120,791,941 Y171H probably damaging Het
Olfr1129 T A 2: 87,575,699 V205D probably damaging Het
Olfr1392 T C 11: 49,293,666 L115P probably damaging Het
Olfr196 T C 16: 59,167,620 I174M possibly damaging Het
Olfr205 T C 16: 59,329,098 K137R probably benign Het
Otud7b C A 3: 96,155,738 Q765K probably benign Het
Pdzd7 A G 19: 45,028,777 V851A probably benign Het
Pi4ka T G 16: 17,325,413 K794T probably damaging Het
Pkhd1l1 T A 15: 44,546,862 N2588K probably damaging Het
Pla2g6 A T 15: 79,302,637 M471K probably benign Het
Plagl2 T C 2: 153,235,839 H74R possibly damaging Het
Prf1 T A 10: 61,300,258 N104K probably benign Het
Ptprf A T 4: 118,236,389 I358N probably damaging Het
Rcsd1 A G 1: 165,655,303 probably null Het
Rev1 G A 1: 38,108,451 R3* probably null Het
Rp1 T C 1: 4,349,360 probably null Het
Rrp12 G A 19: 41,892,596 T132I probably damaging Het
Sema3a T C 5: 13,599,389 V702A probably benign Het
Serpinb12 A G 1: 106,956,444 N307D probably damaging Het
Slc35d1 A G 4: 103,213,186 L103P probably damaging Het
Smyd4 T C 11: 75,390,939 C413R probably damaging Het
Stab1 G A 14: 31,161,836 Q255* probably null Het
Synpo T A 18: 60,603,846 I343F possibly damaging Het
Tcirg1 A G 19: 3,902,342 probably null Het
Tmem132c A G 5: 127,563,752 T996A possibly damaging Het
Trim10 A G 17: 36,870,189 E104G probably damaging Het
Trpc1 T C 9: 95,721,471 probably null Het
Tspo2 A T 17: 48,449,859 probably benign Het
Ugt2a3 A T 5: 87,331,315 I258N probably damaging Het
Usp34 T C 11: 23,468,846 L2998P probably damaging Het
Vmn1r45 A C 6: 89,933,141 D162E possibly damaging Het
Vmn2r117 A T 17: 23,477,874 Y186* probably null Het
Vmn2r67 A G 7: 85,136,490 F769S probably damaging Het
Zbtb17 A G 4: 141,465,631 I514V probably benign Het
Zfp329 A C 7: 12,811,494 D34E probably benign Het
Other mutations in Bms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Bms1 APN 6 118404583 missense probably benign 0.01
IGL00763:Bms1 APN 6 118418402 splice site probably benign
IGL00839:Bms1 APN 6 118405291 missense probably benign 0.30
IGL02005:Bms1 APN 6 118404585 missense probably damaging 1.00
IGL02271:Bms1 APN 6 118389329 missense probably benign 0.10
IGL02403:Bms1 APN 6 118405224 missense possibly damaging 0.89
IGL02474:Bms1 APN 6 118416519 missense probably benign 0.00
IGL03230:Bms1 APN 6 118418561 missense possibly damaging 0.88
IGL03277:Bms1 APN 6 118405122 missense probably benign
PIT4508001:Bms1 UTSW 6 118383806 missense probably benign 0.03
R0028:Bms1 UTSW 6 118416519 missense probably benign 0.00
R0056:Bms1 UTSW 6 118405229 missense probably benign 0.00
R0056:Bms1 UTSW 6 118405229 missense probably benign 0.00
R0276:Bms1 UTSW 6 118408134 missense possibly damaging 0.87
R0295:Bms1 UTSW 6 118389337 missense probably benign 0.04
R0360:Bms1 UTSW 6 118405290 missense probably benign 0.13
R0556:Bms1 UTSW 6 118413179 missense probably damaging 1.00
R1078:Bms1 UTSW 6 118405221 missense probably benign 0.00
R1583:Bms1 UTSW 6 118389389 splice site probably benign
R1815:Bms1 UTSW 6 118383781 missense probably damaging 1.00
R1957:Bms1 UTSW 6 118392978 missense probably damaging 0.98
R2045:Bms1 UTSW 6 118392627 missense probably damaging 1.00
R2511:Bms1 UTSW 6 118391153 splice site probably null
R4293:Bms1 UTSW 6 118405347 splice site probably null
R4296:Bms1 UTSW 6 118404999 missense probably damaging 0.96
R4467:Bms1 UTSW 6 118383847 missense probably damaging 0.99
R4688:Bms1 UTSW 6 118392706 missense probably damaging 1.00
R4718:Bms1 UTSW 6 118403235 missense possibly damaging 0.91
R5015:Bms1 UTSW 6 118404263 nonsense probably null
R5489:Bms1 UTSW 6 118413745 missense possibly damaging 0.64
R5511:Bms1 UTSW 6 118388887 missense possibly damaging 0.85
R5636:Bms1 UTSW 6 118388825 missense probably benign 0.00
R5815:Bms1 UTSW 6 118404279 missense probably damaging 1.00
R6245:Bms1 UTSW 6 118396836 missense probably damaging 0.96
R6299:Bms1 UTSW 6 118418515 missense probably damaging 0.98
R6389:Bms1 UTSW 6 118403235 missense possibly damaging 0.91
R6838:Bms1 UTSW 6 118416494 missense probably benign 0.00
R7129:Bms1 UTSW 6 118403161 nonsense probably null
R7414:Bms1 UTSW 6 118383745 missense possibly damaging 0.93
R7811:Bms1 UTSW 6 118403138 missense probably damaging 0.99
R7883:Bms1 UTSW 6 118388774 missense probably benign 0.04
R7966:Bms1 UTSW 6 118388774 missense probably benign 0.04
R8046:Bms1 UTSW 6 118408144 missense not run
R8068:Bms1 UTSW 6 118413750 missense not run
X0067:Bms1 UTSW 6 118404834 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GTCAGCACTGCTTTCATCCG -3'
(R):5'- ACTGGCATTAGCTTCTTACTGCAC -3'

Sequencing Primer
(F):5'- TCAAGGTCATCATCGCTATCAG -3'
(R):5'- GCTTCTTACTGCACAGTTTGAATTG -3'
Posted On2016-08-04