Mutagenetix > Incidental Mutations

Incidental Mutation 'R5327:Cacna2d2'

422056

Institutional Source

Beutler Lab

Gene Symbol

Cacna2d2

Ensembl Gene

ENSMUSG00000010066

Gene Name

calcium channel, voltage-dependent, alpha 2/delta subunit 2

Synonyms

a2d2

MMRRC Submission

042910-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.878) question?

Stock #

R5327 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107399612-107529343 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107513606 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 379 (E379G)

Ref Sequence

ENSEMBL: ENSMUSP00000125943 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010210] [ENSMUST00000085092] [ENSMUST00000164988] [ENSMUST00000166799] [ENSMUST00000168532] [ENSMUST00000170737]

Predicted Effect

probably null
Transcript: ENSMUST00000010210
AA Change: E379G

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000010210
Gene: ENSMUSG00000010066
AA Change: E379G

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	9.9e-32	PFAM
Pfam:VGCC_alpha2	583	673	1.8e-33	PFAM
low complexity region	968	977	N/A	INTRINSIC
low complexity region	1114	1137	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000085092
AA Change: E379G

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000082173
Gene: ENSMUSG00000010066
AA Change: E379G

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	1e-31	PFAM
Pfam:VGCC_alpha2	583	676	5.8e-35	PFAM
low complexity region	974	983	N/A	INTRINSIC
low complexity region	1120	1143	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000164988
AA Change: E379G

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000130451
Gene: ENSMUSG00000010066
AA Change: E379G

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	6.7e-49	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	2.4e-31	PFAM
Pfam:VGCC_alpha2	583	675	2.5e-34	PFAM
low complexity region	974	983	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000166799
AA Change: E379G

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126029
Gene: ENSMUSG00000010066
AA Change: E379G

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	8.5e-44	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	576	1.3e-32	PFAM
Pfam:VGCC_alpha2	583	675	1.4e-47	PFAM
low complexity region	975	984	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000168532
AA Change: E379G

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000132512
Gene: ENSMUSG00000010066
AA Change: E379G

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2.1e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	1e-31	PFAM
Pfam:VGCC_alpha2	583	676	5.8e-35	PFAM
low complexity region	974	983	N/A	INTRINSIC
low complexity region	1122	1145	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169354

Predicted Effect

probably null
Transcript: ENSMUST00000170737
AA Change: E379G

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000125943
Gene: ENSMUSG00000010066
AA Change: E379G

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	1e-31	PFAM
Pfam:VGCC_alpha2	583	673	1.9e-33	PFAM
low complexity region	968	977	N/A	INTRINSIC
low complexity region	1116	1139	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171809

Meta Mutation Damage Score

0.1007

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (101/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium channels mediate the entry of calcium ions into the cell upon membrane polarization. This gene encodes the alpha-2/delta subunit of the voltage-dependent calcium channel complex. The complex consists of the main channel-forming subunit alpha-1, and auxiliary subunits alpha-2/delta, beta, and gamma. The auxiliary subunits function in the assembly and membrane localization of the complex, and modulate calcium currents and channel activation/inactivation kinetics. The subunit encoded by this gene undergoes post-translational cleavage to yield the extracellular alpha2 peptide and a membrane-anchored delta polypeptide. This subunit is a receptor for the antiepileptic drug, gabapentin. Mutations in this gene are associated with early infantile epileptic encephalopathy. Single nucleotide polymorphisms in this gene are correlated with increased sensitivity to opioid drugs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for different mutant alleles show variable movement abnormalities including waddling, reeling or very slow gait, ataxia, and mild spike-wave seizures. While gross CNS abnormalities and demyelination are present in some mutant lines, they are not observed in others. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA986860	A	G	1: 130,741,003	S36G	probably damaging	Het
Aarsd1	T	C	11: 101,410,377	N280D	probably benign	Het
Abca2	T	A	2: 25,445,674	M2099K	probably damaging	Het
Abcb5	T	A	12: 118,911,543	E631D	probably benign	Het
Acss2	T	A	2: 155,573,229	L682Q	probably null	Het
Adamts14	G	A	10: 61,198,488	P1207L	probably benign	Het
Adora1	G	A	1: 134,203,010	R308*	probably null	Het
Arcn1	A	T	9: 44,757,147	V264E	probably benign	Het
B3galt1	G	A	2: 68,118,768	G276S	probably damaging	Het
Bms1	A	T	6: 118,405,218	M453K	possibly damaging	Het
Bnip3l	T	C	14: 66,987,731	Y218C	probably damaging	Het
Cacng6	G	A	7: 3,434,860	G235R	probably damaging	Het
Capn8	A	T	1: 182,628,604	T640S	probably benign	Het
Ccdc106	T	C	7: 5,060,160		probably benign	Het
Ccdc33	A	T	9: 58,086,577	N95K	probably benign	Het
Celsr3	T	A	9: 108,842,708		probably benign	Het
Cemip	A	T	7: 83,955,301	N844K	probably damaging	Het
Chrdl2	A	T	7: 100,028,741	T284S	probably damaging	Het
Ckm	A	G	7: 19,420,165	Y279C	probably damaging	Het
Clvs1	A	T	4: 9,424,261	I236F	probably damaging	Het
Col9a1	T	C	1: 24,195,539		probably null	Het
Csmd1	T	C	8: 17,216,712	E66G	possibly damaging	Het
Ctdsp2	A	G	10: 126,996,054	D26G	probably damaging	Het
Ctsll3	C	A	13: 60,798,907		probably null	Het
Cyp2d12	A	T	15: 82,555,222	M26L	probably benign	Het
Cyp8b1	C	T	9: 121,914,884	D461N	probably damaging	Het
Dbt	A	T	3: 116,528,571		probably benign	Het
Dnah7c	A	G	1: 46,665,568	D2247G	probably benign	Het
Dsg1c	A	G	18: 20,267,937	I166V	possibly damaging	Het
Duoxa1	T	A	2: 122,303,880	E252D	probably damaging	Het
Ezr	T	A	17: 6,753,049	K211M	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fahd2a	T	C	2: 127,441,958	D54G	possibly damaging	Het
Fbxo9	A	T	9: 78,095,864		probably null	Het
Fndc1	A	G	17: 7,772,708	S719P	unknown	Het
Gas7	G	T	11: 67,662,090	G159C	probably damaging	Het
Gba2	T	C	4: 43,574,063	D130G	probably damaging	Het
Gli3	T	G	13: 15,548,507	S78A	probably damaging	Het
Gtpbp6	A	G	5: 110,106,904	F101S	probably damaging	Het
Gzme	G	A	14: 56,117,767	H236Y	probably benign	Het
Hira	T	C	16: 18,954,758	Y943H	probably damaging	Het
Hmbox1	G	A	14: 64,896,695	S152L	possibly damaging	Het
Ibtk	A	G	9: 85,737,466		probably null	Het
Jade1	T	C	3: 41,613,978	I827T	possibly damaging	Het
Jakmip3	A	T	7: 139,025,435	E389D	possibly damaging	Het
Klhdc8b	A	T	9: 108,449,042		probably benign	Het
Lama2	T	C	10: 27,138,946	T1589A	probably benign	Het
Lbx2	A	C	6: 83,087,803	K107T	probably damaging	Het
Ldha	A	G	7: 46,854,098	M259V	probably benign	Het
Lrrtm4	A	G	6: 80,022,637	K344R	probably damaging	Het
Ltb	A	T	17: 35,195,959	E245V	probably damaging	Het
Macf1	GCCCCC	GCCCCCC	4: 123,350,991		probably null	Het
Map3k13	T	A	16: 21,921,647	S575T	possibly damaging	Het
Mcpt2	A	T	14: 56,043,376	I74F	probably damaging	Het
Mpeg1	T	A	19: 12,461,649	V157D	probably damaging	Het
Mrpl21	A	T	19: 3,287,009		probably null	Het
Nagpa	T	C	16: 5,200,013	T99A	possibly damaging	Het
Nphs1	A	T	7: 30,463,825	I469F	probably benign	Het
Nyap2	A	G	1: 81,192,041	E171G	possibly damaging	Het
Oas1e	A	G	5: 120,791,941	Y171H	probably damaging	Het
Olfr1129	T	A	2: 87,575,699	V205D	probably damaging	Het
Olfr1392	T	C	11: 49,293,666	L115P	probably damaging	Het
Olfr196	T	C	16: 59,167,620	I174M	possibly damaging	Het
Olfr205	T	C	16: 59,329,098	K137R	probably benign	Het
Otud7b	C	A	3: 96,155,738	Q765K	probably benign	Het
Pdzd7	A	G	19: 45,028,777	V851A	probably benign	Het
Pi4ka	T	G	16: 17,325,413	K794T	probably damaging	Het
Pkhd1l1	T	A	15: 44,546,862	N2588K	probably damaging	Het
Pla2g6	A	T	15: 79,302,637	M471K	probably benign	Het
Plagl2	T	C	2: 153,235,839	H74R	possibly damaging	Het
Prf1	T	A	10: 61,300,258	N104K	probably benign	Het
Ptprf	A	T	4: 118,236,389	I358N	probably damaging	Het
Rcsd1	A	G	1: 165,655,303		probably null	Het
Rev1	G	A	1: 38,108,451	R3*	probably null	Het
Rp1	T	C	1: 4,349,360		probably null	Het
Rrp12	G	A	19: 41,892,596	T132I	probably damaging	Het
Sema3a	T	C	5: 13,599,389	V702A	probably benign	Het
Serpinb12	A	G	1: 106,956,444	N307D	probably damaging	Het
Slc35d1	A	G	4: 103,213,186	L103P	probably damaging	Het
Smyd4	T	C	11: 75,390,939	C413R	probably damaging	Het
Stab1	G	A	14: 31,161,836	Q255*	probably null	Het
Synpo	T	A	18: 60,603,846	I343F	possibly damaging	Het
Tcirg1	A	G	19: 3,902,342		probably null	Het
Tmem132c	A	G	5: 127,563,752	T996A	possibly damaging	Het
Trim10	A	G	17: 36,870,189	E104G	probably damaging	Het
Trpc1	T	C	9: 95,721,471		probably null	Het
Tspo2	A	T	17: 48,449,859		probably benign	Het
Ugt2a3	A	T	5: 87,331,315	I258N	probably damaging	Het
Usp34	T	C	11: 23,468,846	L2998P	probably damaging	Het
Vmn1r45	A	C	6: 89,933,141	D162E	possibly damaging	Het
Vmn2r117	A	T	17: 23,477,874	Y186*	probably null	Het
Vmn2r67	A	G	7: 85,136,490	F769S	probably damaging	Het
Zbtb17	A	G	4: 141,465,631	I514V	probably benign	Het
Zfp329	A	C	7: 12,811,494	D34E	probably benign	Het

Other mutations in Cacna2d2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Cacna2d2	APN	9	107514873	missense	probably damaging	1.00
IGL00425:Cacna2d2	APN	9	107527351	missense	probably damaging	1.00
IGL01294:Cacna2d2	APN	9	107514081	missense	probably damaging	1.00
IGL01969:Cacna2d2	APN	9	107509216	missense	probably benign
IGL01974:Cacna2d2	APN	9	107517422	missense	probably benign	0.00
IGL02001:Cacna2d2	APN	9	107522116	missense	probably benign
IGL02125:Cacna2d2	APN	9	107513904	nonsense	probably null
IGL02143:Cacna2d2	APN	9	107518275	splice site	probably null
IGL02150:Cacna2d2	APN	9	107527316	splice site	probably benign
IGL02213:Cacna2d2	APN	9	107514048	missense	probably damaging	1.00
IGL02220:Cacna2d2	APN	9	107514879	missense	probably damaging	1.00
IGL02238:Cacna2d2	APN	9	107513558	missense	probably damaging	0.99
IGL02466:Cacna2d2	APN	9	107465554	missense	probably damaging	1.00
IGL02569:Cacna2d2	APN	9	107514046	missense	probably damaging	0.99
IGL02571:Cacna2d2	APN	9	107525646	missense	possibly damaging	0.93
IGL02825:Cacna2d2	APN	9	107524460	missense	probably damaging	1.00
IGL03000:Cacna2d2	APN	9	107524198	splice site	probably null
IGL03064:Cacna2d2	APN	9	107509275	missense	probably damaging	1.00
Blow	UTSW	9	107513606	missense	probably null	0.90
dilemma	UTSW	9	107514864	missense	probably damaging	1.00
hera	UTSW	9	107513280	missense	probably damaging	1.00
Ionian	UTSW	9	107525376	missense	probably benign	0.05
PIT4131001:Cacna2d2	UTSW	9	107524668	missense	probably damaging	1.00
R0233:Cacna2d2	UTSW	9	107514670	missense	probably damaging	0.96
R0233:Cacna2d2	UTSW	9	107514670	missense	probably damaging	0.96
R0387:Cacna2d2	UTSW	9	107513881	missense	probably damaging	1.00
R0410:Cacna2d2	UTSW	9	107524620	missense	probably damaging	1.00
R0538:Cacna2d2	UTSW	9	107524383	splice site	probably benign
R0545:Cacna2d2	UTSW	9	107525223	missense	probably damaging	1.00
R0729:Cacna2d2	UTSW	9	107517257	missense	probably benign	0.06
R1024:Cacna2d2	UTSW	9	107527050	critical splice donor site	probably null
R1538:Cacna2d2	UTSW	9	107517416	missense	probably damaging	1.00
R1750:Cacna2d2	UTSW	9	107524644	missense	probably damaging	1.00
R1774:Cacna2d2	UTSW	9	107526151	missense	probably benign	0.19
R1800:Cacna2d2	UTSW	9	107527433	missense	possibly damaging	0.46
R1873:Cacna2d2	UTSW	9	107513872	missense	probably damaging	0.98
R1935:Cacna2d2	UTSW	9	107509256	missense	probably damaging	1.00
R1936:Cacna2d2	UTSW	9	107509256	missense	probably damaging	1.00
R1971:Cacna2d2	UTSW	9	107512006	missense	probably damaging	0.98
R2095:Cacna2d2	UTSW	9	107527165	missense	probably benign	0.05
R2135:Cacna2d2	UTSW	9	107526513	missense	possibly damaging	0.74
R2197:Cacna2d2	UTSW	9	107527403	missense	probably damaging	0.97
R2266:Cacna2d2	UTSW	9	107513280	missense	probably damaging	1.00
R2483:Cacna2d2	UTSW	9	107512022	missense	probably damaging	1.00
R4021:Cacna2d2	UTSW	9	107514058	missense	probably damaging	1.00
R4392:Cacna2d2	UTSW	9	107400280	missense	possibly damaging	0.47
R4629:Cacna2d2	UTSW	9	107527322	missense	probably damaging	1.00
R5053:Cacna2d2	UTSW	9	107514864	missense	probably damaging	1.00
R5347:Cacna2d2	UTSW	9	107514114	missense	probably benign
R5719:Cacna2d2	UTSW	9	107524652	missense	probably benign	0.36
R5737:Cacna2d2	UTSW	9	107526747	missense	possibly damaging	0.70
R5739:Cacna2d2	UTSW	9	107512329	missense	probably benign	0.37
R6037:Cacna2d2	UTSW	9	107513539	missense	probably damaging	1.00
R6037:Cacna2d2	UTSW	9	107513539	missense	probably damaging	1.00
R6084:Cacna2d2	UTSW	9	107497521	critical splice donor site	probably null
R6170:Cacna2d2	UTSW	9	107527334	missense	probably damaging	1.00
R6254:Cacna2d2	UTSW	9	107509216	missense	probably benign
R6427:Cacna2d2	UTSW	9	107515442	missense	possibly damaging	0.67
R7652:Cacna2d2	UTSW	9	107524198	splice site	probably null
R7850:Cacna2d2	UTSW	9	107525376	missense	probably benign	0.05
R7936:Cacna2d2	UTSW	9	107524127	missense	probably damaging	1.00
R7978:Cacna2d2	UTSW	9	107518257	missense	probably benign	0.14
R8039:Cacna2d2	UTSW	9	107527433	missense	possibly damaging	0.92
R8165:Cacna2d2	UTSW	9	107525454	splice site	probably null
R8274:Cacna2d2	UTSW	9	107524662	missense	possibly damaging	0.94
R8286:Cacna2d2	UTSW	9	107514864	missense	probably damaging	1.00
R8354:Cacna2d2	UTSW	9	107524135	missense	possibly damaging	0.95
R8464:Cacna2d2	UTSW	9	107512007	missense	probably damaging	0.99
R8479:Cacna2d2	UTSW	9	107526397	critical splice donor site	probably null
R8765:Cacna2d2	UTSW	9	107517159	missense	probably damaging	1.00
Z1176:Cacna2d2	UTSW	9	107517293	missense	probably damaging	1.00
Z1176:Cacna2d2	UTSW	9	107526102	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- TGTACAACAGCTGCACACTG -3'
(R):5'- GCAATCCTTGGTCTCTCACAGG -3'

Sequencing Primer
(F):5'- ACTGTGTGGCCAGCCTGAAG -3'
(R):5'- TTGGTCTCTCACAGGTCCAGG -3'

Posted On

2016-08-04