Mutagenetix > Incidental Mutations

Incidental Mutation 'R5327:Adamts14'

422061

Institutional Source

Beutler Lab

Gene Symbol

Adamts14

Ensembl Gene

ENSMUSG00000059901

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 14

Synonyms

Adamts-14, TS14

MMRRC Submission

042910-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5327 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61197112-61273438 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 61198488 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 1207 (P1207L)

Ref Sequence

ENSEMBL: ENSMUSP00000112723 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092486] [ENSMUST00000120336]

Predicted Effect

probably benign
Transcript: ENSMUST00000092486
AA Change: P1204L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000090143
Gene: ENSMUSG00000059901
AA Change: P1204L

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Pep_M12B_propep	38	194	6.3e-30	PFAM
Pfam:Reprolysin_5	245	424	6e-17	PFAM
Pfam:Reprolysin_4	246	432	2.5e-7	PFAM
Pfam:Reprolysin	246	447	1.9e-21	PFAM
Pfam:Reprolysin_2	264	437	9.2e-10	PFAM
Pfam:Reprolysin_3	268	396	2.5e-12	PFAM
TSP1	542	594	5.9e-16	SMART
Pfam:ADAM_spacer1	701	816	1.8e-24	PFAM
TSP1	837	894	2.1e-2	SMART
TSP1	897	956	3.42e-3	SMART
TSP1	959	1009	4.48e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120336
AA Change: P1207L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000112723
Gene: ENSMUSG00000059901
AA Change: P1207L

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Pep_M12B_propep	39	194	1.6e-38	PFAM
Pfam:Reprolysin_5	245	427	5.9e-16	PFAM
Pfam:Reprolysin_4	246	435	1.1e-7	PFAM
Pfam:Reprolysin	246	450	3.2e-20	PFAM
Pfam:Reprolysin_2	264	441	5.5e-12	PFAM
Pfam:Reprolysin_3	268	399	1.5e-13	PFAM
TSP1	545	597	5.9e-16	SMART
Pfam:ADAM_spacer1	704	819	8e-25	PFAM
TSP1	840	897	2.1e-2	SMART
TSP1	900	959	3.42e-3	SMART
TSP1	962	1012	4.48e-7	SMART

Meta Mutation Damage Score

0.0600

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (101/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme cleaves amino-terminal propeptides from type I procollagen, a necessary step in the formation of collagen fibers. Mutations in this gene may be associated with osteoarthritis in human patients. [provided by RefSeq, May 2016]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA986860	A	G	1: 130,741,003	S36G	probably damaging	Het
Aarsd1	T	C	11: 101,410,377	N280D	probably benign	Het
Abca2	T	A	2: 25,445,674	M2099K	probably damaging	Het
Abcb5	T	A	12: 118,911,543	E631D	probably benign	Het
Acss2	T	A	2: 155,573,229	L682Q	probably null	Het
Adora1	G	A	1: 134,203,010	R308*	probably null	Het
Arcn1	A	T	9: 44,757,147	V264E	probably benign	Het
B3galt1	G	A	2: 68,118,768	G276S	probably damaging	Het
Bms1	A	T	6: 118,405,218	M453K	possibly damaging	Het
Bnip3l	T	C	14: 66,987,731	Y218C	probably damaging	Het
Cacna2d2	A	G	9: 107,513,606	E379G	probably null	Het
Cacng6	G	A	7: 3,434,860	G235R	probably damaging	Het
Capn8	A	T	1: 182,628,604	T640S	probably benign	Het
Ccdc106	T	C	7: 5,060,160		probably benign	Het
Ccdc33	A	T	9: 58,086,577	N95K	probably benign	Het
Celsr3	T	A	9: 108,842,708		probably benign	Het
Cemip	A	T	7: 83,955,301	N844K	probably damaging	Het
Chrdl2	A	T	7: 100,028,741	T284S	probably damaging	Het
Ckm	A	G	7: 19,420,165	Y279C	probably damaging	Het
Clvs1	A	T	4: 9,424,261	I236F	probably damaging	Het
Col9a1	T	C	1: 24,195,539		probably null	Het
Csmd1	T	C	8: 17,216,712	E66G	possibly damaging	Het
Ctdsp2	A	G	10: 126,996,054	D26G	probably damaging	Het
Ctsll3	C	A	13: 60,798,907		probably null	Het
Cyp2d12	A	T	15: 82,555,222	M26L	probably benign	Het
Cyp8b1	C	T	9: 121,914,884	D461N	probably damaging	Het
Dbt	A	T	3: 116,528,571		probably benign	Het
Dnah7c	A	G	1: 46,665,568	D2247G	probably benign	Het
Dsg1c	A	G	18: 20,267,937	I166V	possibly damaging	Het
Duoxa1	T	A	2: 122,303,880	E252D	probably damaging	Het
Ezr	T	A	17: 6,753,049	K211M	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fahd2a	T	C	2: 127,441,958	D54G	possibly damaging	Het
Fbxo9	A	T	9: 78,095,864		probably null	Het
Fndc1	A	G	17: 7,772,708	S719P	unknown	Het
Gas7	G	T	11: 67,662,090	G159C	probably damaging	Het
Gba2	T	C	4: 43,574,063	D130G	probably damaging	Het
Gli3	T	G	13: 15,548,507	S78A	probably damaging	Het
Gtpbp6	A	G	5: 110,106,904	F101S	probably damaging	Het
Gzme	G	A	14: 56,117,767	H236Y	probably benign	Het
Hira	T	C	16: 18,954,758	Y943H	probably damaging	Het
Hmbox1	G	A	14: 64,896,695	S152L	possibly damaging	Het
Ibtk	A	G	9: 85,737,466		probably null	Het
Jade1	T	C	3: 41,613,978	I827T	possibly damaging	Het
Jakmip3	A	T	7: 139,025,435	E389D	possibly damaging	Het
Klhdc8b	A	T	9: 108,449,042		probably benign	Het
Lama2	T	C	10: 27,138,946	T1589A	probably benign	Het
Lbx2	A	C	6: 83,087,803	K107T	probably damaging	Het
Ldha	A	G	7: 46,854,098	M259V	probably benign	Het
Lrrtm4	A	G	6: 80,022,637	K344R	probably damaging	Het
Ltb	A	T	17: 35,195,959	E245V	probably damaging	Het
Macf1	GCCCCC	GCCCCCC	4: 123,350,991		probably null	Het
Map3k13	T	A	16: 21,921,647	S575T	possibly damaging	Het
Mcpt2	A	T	14: 56,043,376	I74F	probably damaging	Het
Mpeg1	T	A	19: 12,461,649	V157D	probably damaging	Het
Mrpl21	A	T	19: 3,287,009		probably null	Het
Nagpa	T	C	16: 5,200,013	T99A	possibly damaging	Het
Nphs1	A	T	7: 30,463,825	I469F	probably benign	Het
Nyap2	A	G	1: 81,192,041	E171G	possibly damaging	Het
Oas1e	A	G	5: 120,791,941	Y171H	probably damaging	Het
Olfr1129	T	A	2: 87,575,699	V205D	probably damaging	Het
Olfr1392	T	C	11: 49,293,666	L115P	probably damaging	Het
Olfr196	T	C	16: 59,167,620	I174M	possibly damaging	Het
Olfr205	T	C	16: 59,329,098	K137R	probably benign	Het
Otud7b	C	A	3: 96,155,738	Q765K	probably benign	Het
Pdzd7	A	G	19: 45,028,777	V851A	probably benign	Het
Pi4ka	T	G	16: 17,325,413	K794T	probably damaging	Het
Pkhd1l1	T	A	15: 44,546,862	N2588K	probably damaging	Het
Pla2g6	A	T	15: 79,302,637	M471K	probably benign	Het
Plagl2	T	C	2: 153,235,839	H74R	possibly damaging	Het
Prf1	T	A	10: 61,300,258	N104K	probably benign	Het
Ptprf	A	T	4: 118,236,389	I358N	probably damaging	Het
Rcsd1	A	G	1: 165,655,303		probably null	Het
Rev1	G	A	1: 38,108,451	R3*	probably null	Het
Rp1	T	C	1: 4,349,360		probably null	Het
Rrp12	G	A	19: 41,892,596	T132I	probably damaging	Het
Sema3a	T	C	5: 13,599,389	V702A	probably benign	Het
Serpinb12	A	G	1: 106,956,444	N307D	probably damaging	Het
Slc35d1	A	G	4: 103,213,186	L103P	probably damaging	Het
Smyd4	T	C	11: 75,390,939	C413R	probably damaging	Het
Stab1	G	A	14: 31,161,836	Q255*	probably null	Het
Synpo	T	A	18: 60,603,846	I343F	possibly damaging	Het
Tcirg1	A	G	19: 3,902,342		probably null	Het
Tmem132c	A	G	5: 127,563,752	T996A	possibly damaging	Het
Trim10	A	G	17: 36,870,189	E104G	probably damaging	Het
Trpc1	T	C	9: 95,721,471		probably null	Het
Tspo2	A	T	17: 48,449,859		probably benign	Het
Ugt2a3	A	T	5: 87,331,315	I258N	probably damaging	Het
Usp34	T	C	11: 23,468,846	L2998P	probably damaging	Het
Vmn1r45	A	C	6: 89,933,141	D162E	possibly damaging	Het
Vmn2r117	A	T	17: 23,477,874	Y186*	probably null	Het
Vmn2r67	A	G	7: 85,136,490	F769S	probably damaging	Het
Zbtb17	A	G	4: 141,465,631	I514V	probably benign	Het
Zfp329	A	C	7: 12,811,494	D34E	probably benign	Het

Other mutations in Adamts14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Adamts14	APN	10	61229676	missense	probably damaging	1.00
IGL00800:Adamts14	APN	10	61205418	missense	probably benign	0.00
IGL01021:Adamts14	APN	10	61225373	missense	probably damaging	0.99
IGL01022:Adamts14	APN	10	61202942	missense	probably benign	0.01
IGL01335:Adamts14	APN	10	61198681	missense	possibly damaging	0.90
IGL01419:Adamts14	APN	10	61205542	splice site	probably benign
IGL01595:Adamts14	APN	10	61205473	missense	probably damaging	1.00
R0594:Adamts14	UTSW	10	61202887	missense	probably damaging	1.00
R0629:Adamts14	UTSW	10	61211624	nonsense	probably null
R1459:Adamts14	UTSW	10	61198804	missense	probably benign	0.13
R1565:Adamts14	UTSW	10	61270897	missense	probably damaging	1.00
R1686:Adamts14	UTSW	10	61198660	missense	probably benign
R1792:Adamts14	UTSW	10	61218498	missense	probably benign	0.07
R1876:Adamts14	UTSW	10	61200372	missense	probably benign	0.03
R1992:Adamts14	UTSW	10	61198660	missense	probably benign
R2064:Adamts14	UTSW	10	61205522	missense	probably benign	0.24
R2495:Adamts14	UTSW	10	61198970	splice site	probably null
R2848:Adamts14	UTSW	10	61218435	missense	probably damaging	1.00
R2897:Adamts14	UTSW	10	61204910	missense	probably damaging	0.99
R3428:Adamts14	UTSW	10	61224374	missense	probably benign	0.36
R4006:Adamts14	UTSW	10	61202821	critical splice donor site	probably null
R5129:Adamts14	UTSW	10	61249618	missense	probably benign	0.02
R5524:Adamts14	UTSW	10	61230443	missense	probably damaging	1.00
R5594:Adamts14	UTSW	10	61227101	splice site	probably null
R5694:Adamts14	UTSW	10	61229652	missense	probably benign	0.45
R5801:Adamts14	UTSW	10	61202996	missense	probably damaging	0.99
R5941:Adamts14	UTSW	10	61221895	missense	probably damaging	1.00
R5953:Adamts14	UTSW	10	61207446	missense	probably damaging	0.99
R6778:Adamts14	UTSW	10	61225452	missense	probably damaging	1.00
R7169:Adamts14	UTSW	10	61204928	missense	probably damaging	0.97
R7215:Adamts14	UTSW	10	61211596	missense	possibly damaging	0.89
R7337:Adamts14	UTSW	10	61207460	missense	probably damaging	0.98
R7511:Adamts14	UTSW	10	61218528	missense	possibly damaging	0.74
R7640:Adamts14	UTSW	10	61246057	missense	probably benign	0.00
R7798:Adamts14	UTSW	10	61271173	missense	probably damaging	0.99
R7902:Adamts14	UTSW	10	61205397	missense	possibly damaging	0.92
R7985:Adamts14	UTSW	10	61205397	missense	possibly damaging	0.92
Z1088:Adamts14	UTSW	10	61218445	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTCACGGGAGTAAAGAGC -3'
(R):5'- CCTGGAAGATCATCGGCAAAGC -3'

Sequencing Primer
(F):5'- GAGTAAAGAGCGTCACAGCCC -3'
(R):5'- AGTGACTCAGTATCCGGTCAC -3'

Posted On

2016-08-04