Incidental Mutation 'R5327:Abcb5'
ID 422071
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene Name ATP-binding cassette, sub-family B member 5
Synonyms 9230106F14Rik
MMRRC Submission 042910-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.177) question?
Stock # R5327 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 118831559-118930156 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118875278 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 631 (E631D)
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
AlphaFold B5X0E4
Predicted Effect probably benign
Transcript: ENSMUST00000035515
AA Change: E631D

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: E631D

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100982
Meta Mutation Damage Score 0.0707 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,668,740 (GRCm39) S36G probably damaging Het
Aarsd1 T C 11: 101,301,203 (GRCm39) N280D probably benign Het
Abca2 T A 2: 25,335,686 (GRCm39) M2099K probably damaging Het
Acss2 T A 2: 155,415,149 (GRCm39) L682Q probably null Het
Adamts14 G A 10: 61,034,267 (GRCm39) P1207L probably benign Het
Adora1 G A 1: 134,130,748 (GRCm39) R308* probably null Het
Arcn1 A T 9: 44,668,444 (GRCm39) V264E probably benign Het
B3galt1 G A 2: 67,949,112 (GRCm39) G276S probably damaging Het
Bms1 A T 6: 118,382,179 (GRCm39) M453K possibly damaging Het
Bnip3l T C 14: 67,225,180 (GRCm39) Y218C probably damaging Het
Cacna2d2 A G 9: 107,390,805 (GRCm39) E379G probably null Het
Cacng6 G A 7: 3,483,376 (GRCm39) G235R probably damaging Het
Capn8 A T 1: 182,456,169 (GRCm39) T640S probably benign Het
Ccdc106 T C 7: 5,063,159 (GRCm39) probably benign Het
Ccdc33 A T 9: 57,993,860 (GRCm39) N95K probably benign Het
Celsr3 T A 9: 108,719,907 (GRCm39) probably benign Het
Cemip A T 7: 83,604,509 (GRCm39) N844K probably damaging Het
Chrdl2 A T 7: 99,677,948 (GRCm39) T284S probably damaging Het
Ckm A G 7: 19,154,090 (GRCm39) Y279C probably damaging Het
Clvs1 A T 4: 9,424,261 (GRCm39) I236F probably damaging Het
Col9a1 T C 1: 24,234,620 (GRCm39) probably null Het
Csmd1 T C 8: 17,266,728 (GRCm39) E66G possibly damaging Het
Ctdsp2 A G 10: 126,831,923 (GRCm39) D26G probably damaging Het
Ctsll3 C A 13: 60,946,721 (GRCm39) probably null Het
Cyp2d12 A T 15: 82,439,423 (GRCm39) M26L probably benign Het
Cyp8b1 C T 9: 121,743,950 (GRCm39) D461N probably damaging Het
Dbt A T 3: 116,322,220 (GRCm39) probably benign Het
Dnah7c A G 1: 46,704,728 (GRCm39) D2247G probably benign Het
Dsg1c A G 18: 20,400,994 (GRCm39) I166V possibly damaging Het
Duoxa1 T A 2: 122,134,361 (GRCm39) E252D probably damaging Het
Ezr T A 17: 7,020,448 (GRCm39) K211M probably damaging Het
Faap100 T A 11: 120,268,458 (GRCm39) E105V possibly damaging Het
Fahd2a T C 2: 127,283,878 (GRCm39) D54G possibly damaging Het
Fbxo9 A T 9: 78,003,146 (GRCm39) probably null Het
Fndc1 A G 17: 7,991,540 (GRCm39) S719P unknown Het
Gas7 G T 11: 67,552,916 (GRCm39) G159C probably damaging Het
Gba2 T C 4: 43,574,063 (GRCm39) D130G probably damaging Het
Gli3 T G 13: 15,723,092 (GRCm39) S78A probably damaging Het
Gtpbp6 A G 5: 110,254,770 (GRCm39) F101S probably damaging Het
Gzme G A 14: 56,355,224 (GRCm39) H236Y probably benign Het
Hira T C 16: 18,773,508 (GRCm39) Y943H probably damaging Het
Hmbox1 G A 14: 65,134,144 (GRCm39) S152L possibly damaging Het
Ibtk A G 9: 85,619,519 (GRCm39) probably null Het
Jade1 T C 3: 41,568,413 (GRCm39) I827T possibly damaging Het
Jakmip3 A T 7: 138,627,164 (GRCm39) E389D possibly damaging Het
Klhdc8b A T 9: 108,326,241 (GRCm39) probably benign Het
Lama2 T C 10: 27,014,942 (GRCm39) T1589A probably benign Het
Lbx2 A C 6: 83,064,784 (GRCm39) K107T probably damaging Het
Ldha A G 7: 46,503,522 (GRCm39) M259V probably benign Het
Lrrtm4 A G 6: 79,999,620 (GRCm39) K344R probably damaging Het
Ltb A T 17: 35,414,935 (GRCm39) E245V probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,244,784 (GRCm39) probably null Het
Map3k13 T A 16: 21,740,397 (GRCm39) S575T possibly damaging Het
Mcpt2 A T 14: 56,280,833 (GRCm39) I74F probably damaging Het
Mpeg1 T A 19: 12,439,013 (GRCm39) V157D probably damaging Het
Mrpl21 A T 19: 3,337,009 (GRCm39) probably null Het
Nagpa T C 16: 5,017,877 (GRCm39) T99A possibly damaging Het
Nphs1 A T 7: 30,163,250 (GRCm39) I469F probably benign Het
Nyap2 A G 1: 81,169,756 (GRCm39) E171G possibly damaging Het
Oas1e A G 5: 120,930,006 (GRCm39) Y171H probably damaging Het
Or10ag59 T A 2: 87,406,043 (GRCm39) V205D probably damaging Het
Or2y1f T C 11: 49,184,493 (GRCm39) L115P probably damaging Het
Or5ac23 T C 16: 59,149,461 (GRCm39) K137R probably benign Het
Or5h26 T C 16: 58,987,983 (GRCm39) I174M possibly damaging Het
Otud7b C A 3: 96,063,055 (GRCm39) Q765K probably benign Het
Pdzd7 A G 19: 45,017,216 (GRCm39) V851A probably benign Het
Pi4ka T G 16: 17,143,277 (GRCm39) K794T probably damaging Het
Pkhd1l1 T A 15: 44,410,258 (GRCm39) N2588K probably damaging Het
Pla2g6 A T 15: 79,186,837 (GRCm39) M471K probably benign Het
Plagl2 T C 2: 153,077,759 (GRCm39) H74R possibly damaging Het
Prf1 T A 10: 61,136,037 (GRCm39) N104K probably benign Het
Ptprf A T 4: 118,093,586 (GRCm39) I358N probably damaging Het
Rcsd1 A G 1: 165,482,872 (GRCm39) probably null Het
Rev1 G A 1: 38,147,532 (GRCm39) R3* probably null Het
Rp1 T C 1: 4,419,583 (GRCm39) probably null Het
Rrp12 G A 19: 41,881,035 (GRCm39) T132I probably damaging Het
Sema3a T C 5: 13,649,357 (GRCm39) V702A probably benign Het
Serpinb12 A G 1: 106,884,174 (GRCm39) N307D probably damaging Het
Slc35d1 A G 4: 103,070,383 (GRCm39) L103P probably damaging Het
Smyd4 T C 11: 75,281,765 (GRCm39) C413R probably damaging Het
Stab1 G A 14: 30,883,793 (GRCm39) Q255* probably null Het
Synpo T A 18: 60,736,918 (GRCm39) I343F possibly damaging Het
Tcirg1 A G 19: 3,952,342 (GRCm39) probably null Het
Tmem132c A G 5: 127,640,816 (GRCm39) T996A possibly damaging Het
Trim10 A G 17: 37,181,081 (GRCm39) E104G probably damaging Het
Trpc1 T C 9: 95,603,524 (GRCm39) probably null Het
Tspo2 A T 17: 48,756,887 (GRCm39) probably benign Het
Ugt2a3 A T 5: 87,479,174 (GRCm39) I258N probably damaging Het
Usp34 T C 11: 23,418,846 (GRCm39) L2998P probably damaging Het
Vmn1r45 A C 6: 89,910,123 (GRCm39) D162E possibly damaging Het
Vmn2r117 A T 17: 23,696,848 (GRCm39) Y186* probably null Het
Vmn2r67 A G 7: 84,785,698 (GRCm39) F769S probably damaging Het
Zbtb17 A G 4: 141,192,942 (GRCm39) I514V probably benign Het
Zfp329 A C 7: 12,545,421 (GRCm39) D34E probably benign Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118,854,345 (GRCm39) missense probably benign 0.03
IGL00092:Abcb5 APN 12 118,892,430 (GRCm39) missense probably benign 0.09
IGL00503:Abcb5 APN 12 118,871,336 (GRCm39) missense probably benign 0.02
IGL00776:Abcb5 APN 12 118,883,589 (GRCm39) missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118,849,911 (GRCm39) missense probably benign
IGL01302:Abcb5 APN 12 118,881,935 (GRCm39) missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118,836,602 (GRCm39) missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118,831,705 (GRCm39) missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118,875,169 (GRCm39) missense probably benign 0.03
IGL01784:Abcb5 APN 12 118,854,399 (GRCm39) missense probably benign 0.14
IGL01967:Abcb5 APN 12 118,831,707 (GRCm39) missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118,891,093 (GRCm39) missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118,904,415 (GRCm39) missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118,838,490 (GRCm39) missense probably benign
IGL02292:Abcb5 APN 12 118,881,932 (GRCm39) missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118,904,413 (GRCm39) missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118,870,003 (GRCm39) splice site probably benign
IGL02685:Abcb5 APN 12 118,869,682 (GRCm39) missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118,854,420 (GRCm39) missense probably benign 0.05
IGL02876:Abcb5 APN 12 118,883,576 (GRCm39) missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118,908,674 (GRCm39) missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118,904,104 (GRCm39) missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118,899,822 (GRCm39) missense probably benign 0.43
IGL03200:Abcb5 APN 12 118,928,989 (GRCm39) splice site probably benign
IGL03407:Abcb5 APN 12 118,904,111 (GRCm39) missense probably benign 0.01
alphabet UTSW 12 118,854,353 (GRCm39) missense possibly damaging 0.67
google UTSW 12 118,831,665 (GRCm39) missense possibly damaging 0.93
F5770:Abcb5 UTSW 12 118,849,914 (GRCm39) missense probably benign 0.07
PIT4366001:Abcb5 UTSW 12 118,899,833 (GRCm39) missense probably damaging 1.00
PIT4434001:Abcb5 UTSW 12 118,854,422 (GRCm39) missense probably damaging 1.00
R0078:Abcb5 UTSW 12 118,891,129 (GRCm39) missense probably benign
R0219:Abcb5 UTSW 12 118,849,885 (GRCm39) splice site probably benign
R0312:Abcb5 UTSW 12 118,836,572 (GRCm39) missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118,928,986 (GRCm39) splice site probably benign
R0359:Abcb5 UTSW 12 118,904,067 (GRCm39) missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118,841,545 (GRCm39) missense probably benign 0.03
R0582:Abcb5 UTSW 12 118,904,147 (GRCm39) missense probably benign 0.40
R0815:Abcb5 UTSW 12 118,865,184 (GRCm39) splice site probably benign
R0900:Abcb5 UTSW 12 118,904,359 (GRCm39) missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118,869,933 (GRCm39) missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118,896,310 (GRCm39) missense probably benign 0.36
R1125:Abcb5 UTSW 12 118,875,282 (GRCm39) missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118,838,497 (GRCm39) missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R1469:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118,929,064 (GRCm39) start gained probably benign
R1726:Abcb5 UTSW 12 118,871,267 (GRCm39) missense possibly damaging 0.95
R1726:Abcb5 UTSW 12 118,838,536 (GRCm39) splice site probably null
R1836:Abcb5 UTSW 12 118,831,696 (GRCm39) missense possibly damaging 0.93
R1934:Abcb5 UTSW 12 118,871,235 (GRCm39) splice site probably null
R1976:Abcb5 UTSW 12 118,854,417 (GRCm39) missense probably benign
R2005:Abcb5 UTSW 12 118,841,562 (GRCm39) missense probably benign 0.15
R2068:Abcb5 UTSW 12 118,904,303 (GRCm39) nonsense probably null
R2181:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R2191:Abcb5 UTSW 12 118,831,691 (GRCm39) missense probably damaging 1.00
R3690:Abcb5 UTSW 12 118,836,668 (GRCm39) missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118,838,355 (GRCm39) missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118,865,087 (GRCm39) splice site probably null
R3919:Abcb5 UTSW 12 118,854,353 (GRCm39) missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118,832,404 (GRCm39) missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118,836,657 (GRCm39) missense probably damaging 0.98
R4606:Abcb5 UTSW 12 118,896,345 (GRCm39) critical splice acceptor site probably null
R4705:Abcb5 UTSW 12 118,929,040 (GRCm39) missense possibly damaging 0.95
R4954:Abcb5 UTSW 12 118,875,169 (GRCm39) missense probably benign 0.03
R4966:Abcb5 UTSW 12 118,850,626 (GRCm39) intron probably benign
R5169:Abcb5 UTSW 12 118,841,552 (GRCm39) nonsense probably null
R5333:Abcb5 UTSW 12 118,831,677 (GRCm39) missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118,831,665 (GRCm39) missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118,850,912 (GRCm39) missense probably damaging 1.00
R5399:Abcb5 UTSW 12 118,875,234 (GRCm39) missense probably benign
R5416:Abcb5 UTSW 12 118,871,331 (GRCm39) missense probably damaging 1.00
R5447:Abcb5 UTSW 12 118,891,061 (GRCm39) missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118,904,425 (GRCm39) missense probably null 1.00
R5566:Abcb5 UTSW 12 118,899,702 (GRCm39) missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118,896,348 (GRCm39) splice site probably null
R5691:Abcb5 UTSW 12 118,890,970 (GRCm39) missense probably damaging 0.99
R5742:Abcb5 UTSW 12 118,881,992 (GRCm39) missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118,891,139 (GRCm39) missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118,832,516 (GRCm39) nonsense probably null
R5994:Abcb5 UTSW 12 118,928,995 (GRCm39) critical splice donor site probably null
R6295:Abcb5 UTSW 12 118,838,379 (GRCm39) missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118,854,284 (GRCm39) critical splice donor site probably null
R6609:Abcb5 UTSW 12 118,892,497 (GRCm39) missense probably damaging 1.00
R6753:Abcb5 UTSW 12 118,908,641 (GRCm39) missense possibly damaging 0.86
R6818:Abcb5 UTSW 12 118,865,089 (GRCm39) splice site probably null
R6870:Abcb5 UTSW 12 118,929,000 (GRCm39) missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118,875,265 (GRCm39) missense probably benign 0.06
R6957:Abcb5 UTSW 12 118,871,270 (GRCm39) missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118,891,012 (GRCm39) missense possibly damaging 0.47
R7021:Abcb5 UTSW 12 118,895,660 (GRCm39) missense probably benign 0.00
R7061:Abcb5 UTSW 12 118,841,509 (GRCm39) missense probably damaging 1.00
R7175:Abcb5 UTSW 12 118,831,611 (GRCm39) missense probably benign 0.00
R7239:Abcb5 UTSW 12 118,892,460 (GRCm39) missense probably benign 0.19
R7267:Abcb5 UTSW 12 118,916,205 (GRCm39) missense probably damaging 1.00
R7303:Abcb5 UTSW 12 118,875,295 (GRCm39) missense probably damaging 0.96
R7396:Abcb5 UTSW 12 118,831,609 (GRCm39) missense probably damaging 1.00
R7605:Abcb5 UTSW 12 118,881,899 (GRCm39) missense probably damaging 1.00
R7989:Abcb5 UTSW 12 118,875,278 (GRCm39) missense probably benign 0.01
R8177:Abcb5 UTSW 12 118,836,525 (GRCm39) missense possibly damaging 0.65
R8296:Abcb5 UTSW 12 118,838,467 (GRCm39) missense probably benign 0.01
R8544:Abcb5 UTSW 12 118,832,461 (GRCm39) missense probably damaging 1.00
R8558:Abcb5 UTSW 12 118,841,566 (GRCm39) missense probably benign 0.07
R8790:Abcb5 UTSW 12 118,831,620 (GRCm39) missense possibly damaging 0.91
R9003:Abcb5 UTSW 12 118,850,013 (GRCm39) missense possibly damaging 0.93
R9038:Abcb5 UTSW 12 118,895,651 (GRCm39) missense probably benign
R9410:Abcb5 UTSW 12 118,869,703 (GRCm39) missense probably benign 0.00
R9497:Abcb5 UTSW 12 118,899,850 (GRCm39) missense probably damaging 0.96
R9666:Abcb5 UTSW 12 118,838,422 (GRCm39) missense probably damaging 0.98
R9682:Abcb5 UTSW 12 118,896,328 (GRCm39) missense probably damaging 0.99
R9756:Abcb5 UTSW 12 118,881,873 (GRCm39) missense probably damaging 0.98
V7580:Abcb5 UTSW 12 118,849,914 (GRCm39) missense probably benign 0.07
Z1176:Abcb5 UTSW 12 118,882,007 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCTTTGTGAACTTAGTGGC -3'
(R):5'- ACATCCTCACCTTCCAACTG -3'

Sequencing Primer
(F):5'- GTGAACTTAGTGGCACTGTTC -3'
(R):5'- AGTGCAGTCCACCATGC -3'
Posted On 2016-08-04