Mutagenetix > Incidental Mutation

Incidental Mutation 'R5327:Abcb5'

422071

Institutional Source

Beutler Lab

Gene Symbol

Abcb5

Ensembl Gene

ENSMUSG00000072791

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 5

Synonyms

9230106F14Rik

MMRRC Submission

042910-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.215) question?

Stock #

R5327 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118867824-118966421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 118911543 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 631 (E631D)

Ref Sequence

ENSEMBL: ENSMUSP00000046177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035515]

AlphaFold

B5X0E4

Predicted Effect

probably benign
Transcript: ENSMUST00000035515
AA Change: E631D

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: E631D

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	49	338	1.9e-74	PFAM
AAA	414	606	2.1e-19	SMART
Pfam:ABC_membrane	693	967	7.3e-59	PFAM
Blast:AAA	969	1040	2e-11	BLAST
AAA	1043	1231	8.26e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000100982

Meta Mutation Damage Score

0.0707

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (101/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA986860	A	G	1: 130,741,003	S36G	probably damaging	Het
Aarsd1	T	C	11: 101,410,377	N280D	probably benign	Het
Abca2	T	A	2: 25,445,674	M2099K	probably damaging	Het
Acss2	T	A	2: 155,573,229	L682Q	probably null	Het
Adamts14	G	A	10: 61,198,488	P1207L	probably benign	Het
Adora1	G	A	1: 134,203,010	R308*	probably null	Het
Arcn1	A	T	9: 44,757,147	V264E	probably benign	Het
B3galt1	G	A	2: 68,118,768	G276S	probably damaging	Het
Bms1	A	T	6: 118,405,218	M453K	possibly damaging	Het
Bnip3l	T	C	14: 66,987,731	Y218C	probably damaging	Het
Cacna2d2	A	G	9: 107,513,606	E379G	probably null	Het
Cacng6	G	A	7: 3,434,860	G235R	probably damaging	Het
Capn8	A	T	1: 182,628,604	T640S	probably benign	Het
Ccdc106	T	C	7: 5,060,160		probably benign	Het
Ccdc33	A	T	9: 58,086,577	N95K	probably benign	Het
Celsr3	T	A	9: 108,842,708		probably benign	Het
Cemip	A	T	7: 83,955,301	N844K	probably damaging	Het
Chrdl2	A	T	7: 100,028,741	T284S	probably damaging	Het
Ckm	A	G	7: 19,420,165	Y279C	probably damaging	Het
Clvs1	A	T	4: 9,424,261	I236F	probably damaging	Het
Col9a1	T	C	1: 24,195,539		probably null	Het
Csmd1	T	C	8: 17,216,712	E66G	possibly damaging	Het
Ctdsp2	A	G	10: 126,996,054	D26G	probably damaging	Het
Ctsll3	C	A	13: 60,798,907		probably null	Het
Cyp2d12	A	T	15: 82,555,222	M26L	probably benign	Het
Cyp8b1	C	T	9: 121,914,884	D461N	probably damaging	Het
Dbt	A	T	3: 116,528,571		probably benign	Het
Dnah7c	A	G	1: 46,665,568	D2247G	probably benign	Het
Dsg1c	A	G	18: 20,267,937	I166V	possibly damaging	Het
Duoxa1	T	A	2: 122,303,880	E252D	probably damaging	Het
Ezr	T	A	17: 6,753,049	K211M	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fahd2a	T	C	2: 127,441,958	D54G	possibly damaging	Het
Fbxo9	A	T	9: 78,095,864		probably null	Het
Fndc1	A	G	17: 7,772,708	S719P	unknown	Het
Gas7	G	T	11: 67,662,090	G159C	probably damaging	Het
Gba2	T	C	4: 43,574,063	D130G	probably damaging	Het
Gli3	T	G	13: 15,548,507	S78A	probably damaging	Het
Gtpbp6	A	G	5: 110,106,904	F101S	probably damaging	Het
Gzme	G	A	14: 56,117,767	H236Y	probably benign	Het
Hira	T	C	16: 18,954,758	Y943H	probably damaging	Het
Hmbox1	G	A	14: 64,896,695	S152L	possibly damaging	Het
Ibtk	A	G	9: 85,737,466		probably null	Het
Jade1	T	C	3: 41,613,978	I827T	possibly damaging	Het
Jakmip3	A	T	7: 139,025,435	E389D	possibly damaging	Het
Klhdc8b	A	T	9: 108,449,042		probably benign	Het
Lama2	T	C	10: 27,138,946	T1589A	probably benign	Het
Lbx2	A	C	6: 83,087,803	K107T	probably damaging	Het
Ldha	A	G	7: 46,854,098	M259V	probably benign	Het
Lrrtm4	A	G	6: 80,022,637	K344R	probably damaging	Het
Ltb	A	T	17: 35,195,959	E245V	probably damaging	Het
Macf1	GCCCCC	GCCCCCC	4: 123,350,991		probably null	Het
Map3k13	T	A	16: 21,921,647	S575T	possibly damaging	Het
Mcpt2	A	T	14: 56,043,376	I74F	probably damaging	Het
Mpeg1	T	A	19: 12,461,649	V157D	probably damaging	Het
Mrpl21	A	T	19: 3,287,009		probably null	Het
Nagpa	T	C	16: 5,200,013	T99A	possibly damaging	Het
Nphs1	A	T	7: 30,463,825	I469F	probably benign	Het
Nyap2	A	G	1: 81,192,041	E171G	possibly damaging	Het
Oas1e	A	G	5: 120,791,941	Y171H	probably damaging	Het
Olfr1129	T	A	2: 87,575,699	V205D	probably damaging	Het
Olfr1392	T	C	11: 49,293,666	L115P	probably damaging	Het
Olfr196	T	C	16: 59,167,620	I174M	possibly damaging	Het
Olfr205	T	C	16: 59,329,098	K137R	probably benign	Het
Otud7b	C	A	3: 96,155,738	Q765K	probably benign	Het
Pdzd7	A	G	19: 45,028,777	V851A	probably benign	Het
Pi4ka	T	G	16: 17,325,413	K794T	probably damaging	Het
Pkhd1l1	T	A	15: 44,546,862	N2588K	probably damaging	Het
Pla2g6	A	T	15: 79,302,637	M471K	probably benign	Het
Plagl2	T	C	2: 153,235,839	H74R	possibly damaging	Het
Prf1	T	A	10: 61,300,258	N104K	probably benign	Het
Ptprf	A	T	4: 118,236,389	I358N	probably damaging	Het
Rcsd1	A	G	1: 165,655,303		probably null	Het
Rev1	G	A	1: 38,108,451	R3*	probably null	Het
Rp1	T	C	1: 4,349,360		probably null	Het
Rrp12	G	A	19: 41,892,596	T132I	probably damaging	Het
Sema3a	T	C	5: 13,599,389	V702A	probably benign	Het
Serpinb12	A	G	1: 106,956,444	N307D	probably damaging	Het
Slc35d1	A	G	4: 103,213,186	L103P	probably damaging	Het
Smyd4	T	C	11: 75,390,939	C413R	probably damaging	Het
Stab1	G	A	14: 31,161,836	Q255*	probably null	Het
Synpo	T	A	18: 60,603,846	I343F	possibly damaging	Het
Tcirg1	A	G	19: 3,902,342		probably null	Het
Tmem132c	A	G	5: 127,563,752	T996A	possibly damaging	Het
Trim10	A	G	17: 36,870,189	E104G	probably damaging	Het
Trpc1	T	C	9: 95,721,471		probably null	Het
Tspo2	A	T	17: 48,449,859		probably benign	Het
Ugt2a3	A	T	5: 87,331,315	I258N	probably damaging	Het
Usp34	T	C	11: 23,468,846	L2998P	probably damaging	Het
Vmn1r45	A	C	6: 89,933,141	D162E	possibly damaging	Het
Vmn2r117	A	T	17: 23,477,874	Y186*	probably null	Het
Vmn2r67	A	G	7: 85,136,490	F769S	probably damaging	Het
Zbtb17	A	G	4: 141,465,631	I514V	probably benign	Het
Zfp329	A	C	7: 12,811,494	D34E	probably benign	Het

Other mutations in Abcb5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Abcb5	APN	12	118890610	missense	probably benign	0.03
IGL00092:Abcb5	APN	12	118928695	missense	probably benign	0.09
IGL00503:Abcb5	APN	12	118907601	missense	probably benign	0.02
IGL00776:Abcb5	APN	12	118919854	missense	probably damaging	1.00
IGL01116:Abcb5	APN	12	118886176	missense	probably benign
IGL01302:Abcb5	APN	12	118918200	missense	probably damaging	1.00
IGL01403:Abcb5	APN	12	118872867	missense	probably damaging	1.00
IGL01453:Abcb5	APN	12	118867970	missense	probably damaging	1.00
IGL01541:Abcb5	APN	12	118911434	missense	probably benign	0.03
IGL01784:Abcb5	APN	12	118890664	missense	probably benign	0.14
IGL01967:Abcb5	APN	12	118867972	missense	probably damaging	1.00
IGL01987:Abcb5	APN	12	118927358	missense	probably damaging	1.00
IGL02104:Abcb5	APN	12	118940680	missense	probably damaging	1.00
IGL02161:Abcb5	APN	12	118874755	missense	probably benign
IGL02292:Abcb5	APN	12	118918197	missense	probably damaging	1.00
IGL02381:Abcb5	APN	12	118940678	missense	probably damaging	1.00
IGL02544:Abcb5	APN	12	118906268	splice site	probably benign
IGL02685:Abcb5	APN	12	118905947	missense	probably damaging	0.99
IGL02824:Abcb5	APN	12	118890685	missense	probably benign	0.05
IGL02876:Abcb5	APN	12	118919841	missense	probably damaging	1.00
IGL02929:Abcb5	APN	12	118944939	missense	probably damaging	0.99
IGL03030:Abcb5	APN	12	118940369	missense	possibly damaging	0.93
IGL03062:Abcb5	APN	12	118936087	missense	probably benign	0.43
IGL03200:Abcb5	APN	12	118965254	splice site	probably benign
IGL03407:Abcb5	APN	12	118940376	missense	probably benign	0.01
alphabet	UTSW	12	118890618	missense	possibly damaging	0.67
google	UTSW	12	118867930	missense	possibly damaging	0.93
F5770:Abcb5	UTSW	12	118886179	missense	probably benign	0.07
PIT4366001:Abcb5	UTSW	12	118936098	missense	probably damaging	1.00
PIT4434001:Abcb5	UTSW	12	118890687	missense	probably damaging	1.00
R0078:Abcb5	UTSW	12	118927394	missense	probably benign
R0219:Abcb5	UTSW	12	118886150	splice site	probably benign
R0312:Abcb5	UTSW	12	118872837	missense	probably damaging	1.00
R0347:Abcb5	UTSW	12	118965251	splice site	probably benign
R0359:Abcb5	UTSW	12	118940332	missense	probably damaging	1.00
R0433:Abcb5	UTSW	12	118877810	missense	probably benign	0.03
R0582:Abcb5	UTSW	12	118940412	missense	probably benign	0.40
R0815:Abcb5	UTSW	12	118901449	splice site	probably benign
R0900:Abcb5	UTSW	12	118940624	missense	probably damaging	1.00
R0942:Abcb5	UTSW	12	118906198	missense	possibly damaging	0.94
R0988:Abcb5	UTSW	12	118932575	missense	probably benign	0.36
R1125:Abcb5	UTSW	12	118911547	missense	possibly damaging	0.87
R1437:Abcb5	UTSW	12	118874762	missense	probably damaging	0.99
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1678:Abcb5	UTSW	12	118965329	start gained	probably benign
R1726:Abcb5	UTSW	12	118874801	splice site	probably null
R1726:Abcb5	UTSW	12	118907532	missense	possibly damaging	0.95
R1836:Abcb5	UTSW	12	118867961	missense	possibly damaging	0.93
R1934:Abcb5	UTSW	12	118907500	splice site	probably null
R1976:Abcb5	UTSW	12	118890682	missense	probably benign
R2005:Abcb5	UTSW	12	118877827	missense	probably benign	0.15
R2068:Abcb5	UTSW	12	118940568	nonsense	probably null
R2181:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R2191:Abcb5	UTSW	12	118867956	missense	probably damaging	1.00
R3690:Abcb5	UTSW	12	118872933	missense	probably damaging	1.00
R3746:Abcb5	UTSW	12	118874620	missense	probably damaging	0.99
R3825:Abcb5	UTSW	12	118901352	splice site	probably null
R3919:Abcb5	UTSW	12	118890618	missense	possibly damaging	0.67
R4049:Abcb5	UTSW	12	118868669	missense	probably damaging	0.99
R4409:Abcb5	UTSW	12	118872922	missense	probably damaging	0.98
R4606:Abcb5	UTSW	12	118932610	critical splice acceptor site	probably null
R4705:Abcb5	UTSW	12	118965305	missense	possibly damaging	0.95
R4954:Abcb5	UTSW	12	118911434	missense	probably benign	0.03
R4966:Abcb5	UTSW	12	118886891	intron	probably benign
R5169:Abcb5	UTSW	12	118877817	nonsense	probably null
R5333:Abcb5	UTSW	12	118867942	missense	probably damaging	1.00
R5366:Abcb5	UTSW	12	118867930	missense	possibly damaging	0.93
R5373:Abcb5	UTSW	12	118887177	missense	probably damaging	1.00
R5399:Abcb5	UTSW	12	118911499	missense	probably benign
R5416:Abcb5	UTSW	12	118907596	missense	probably damaging	1.00
R5447:Abcb5	UTSW	12	118927326	missense	probably damaging	1.00
R5474:Abcb5	UTSW	12	118940690	missense	probably null	1.00
R5566:Abcb5	UTSW	12	118935967	missense	probably damaging	0.99
R5685:Abcb5	UTSW	12	118932613	splice site	probably null
R5691:Abcb5	UTSW	12	118927235	missense	probably damaging	0.99
R5742:Abcb5	UTSW	12	118918257	missense	probably damaging	0.96
R5852:Abcb5	UTSW	12	118927404	missense	probably damaging	0.99
R5917:Abcb5	UTSW	12	118868781	nonsense	probably null
R5994:Abcb5	UTSW	12	118965260	critical splice donor site	probably null
R6295:Abcb5	UTSW	12	118874644	missense	probably damaging	0.99
R6455:Abcb5	UTSW	12	118890549	critical splice donor site	probably null
R6609:Abcb5	UTSW	12	118928762	missense	probably damaging	1.00
R6753:Abcb5	UTSW	12	118944906	missense	possibly damaging	0.86
R6818:Abcb5	UTSW	12	118901354	splice site	probably null
R6870:Abcb5	UTSW	12	118965265	missense	possibly damaging	0.87
R6944:Abcb5	UTSW	12	118911530	missense	probably benign	0.06
R6957:Abcb5	UTSW	12	118907535	missense	probably damaging	1.00
R6984:Abcb5	UTSW	12	118927277	missense	possibly damaging	0.47
R7021:Abcb5	UTSW	12	118931925	missense	probably benign	0.00
R7061:Abcb5	UTSW	12	118877774	missense	probably damaging	1.00
R7175:Abcb5	UTSW	12	118867876	missense	probably benign	0.00
R7239:Abcb5	UTSW	12	118928725	missense	probably benign	0.19
R7267:Abcb5	UTSW	12	118952470	missense	probably damaging	1.00
R7303:Abcb5	UTSW	12	118911560	missense	probably damaging	0.96
R7396:Abcb5	UTSW	12	118867874	missense	probably damaging	1.00
R7605:Abcb5	UTSW	12	118918164	missense	probably damaging	1.00
R7989:Abcb5	UTSW	12	118911543	missense	probably benign	0.01
R8177:Abcb5	UTSW	12	118872790	missense	possibly damaging	0.65
R8296:Abcb5	UTSW	12	118874732	missense	probably benign	0.01
R8544:Abcb5	UTSW	12	118868726	missense	probably damaging	1.00
R8558:Abcb5	UTSW	12	118877831	missense	probably benign	0.07
R8790:Abcb5	UTSW	12	118867885	missense	possibly damaging	0.91
R9003:Abcb5	UTSW	12	118886278	missense	possibly damaging	0.93
R9038:Abcb5	UTSW	12	118931916	missense	probably benign
R9410:Abcb5	UTSW	12	118905968	missense	probably benign	0.00
R9497:Abcb5	UTSW	12	118936115	missense	probably damaging	0.96
R9666:Abcb5	UTSW	12	118874687	missense	probably damaging	0.98
R9682:Abcb5	UTSW	12	118932593	missense	probably damaging	0.99
R9756:Abcb5	UTSW	12	118918138	missense	probably damaging	0.98
V7580:Abcb5	UTSW	12	118886179	missense	probably benign	0.07
Z1176:Abcb5	UTSW	12	118918272	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGCTTTGTGAACTTAGTGGC -3'
(R):5'- ACATCCTCACCTTCCAACTG -3'

Sequencing Primer
(F):5'- GTGAACTTAGTGGCACTGTTC -3'
(R):5'- AGTGCAGTCCACCATGC -3'

Posted On

2016-08-04