Mutagenetix > Incidental Mutation

Incidental Mutation 'R5327:Gli3'

422072

Institutional Source

Beutler Lab

Gene Symbol

Gli3

Ensembl Gene

ENSMUSG00000021318

Gene Name

GLI-Kruppel family member GLI3

Synonyms

brachyphalangy, Bph

MMRRC Submission

042910-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5327 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15463235-15730026 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 15548507 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 78 (S78A)

Ref Sequence

ENSEMBL: ENSMUSP00000106137 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110510] [ENSMUST00000130065] [ENSMUST00000141194]

AlphaFold

Q61602

Predicted Effect

probably damaging
Transcript: ENSMUST00000110510
AA Change: S78A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: S78A

Domain	Start	End	E-Value	Type
low complexity region	120	136	N/A	INTRINSIC
low complexity region	204	220	N/A	INTRINSIC
low complexity region	324	341	N/A	INTRINSIC
low complexity region	403	421	N/A	INTRINSIC
ZnF_C2H2	480	505	1.53e-1	SMART
ZnF_C2H2	513	540	1.23e0	SMART
ZnF_C2H2	546	570	3.16e-3	SMART
ZnF_C2H2	576	601	4.17e-3	SMART
ZnF_C2H2	607	632	1.4e-4	SMART
low complexity region	703	726	N/A	INTRINSIC
low complexity region	756	763	N/A	INTRINSIC
low complexity region	849	880	N/A	INTRINSIC
low complexity region	934	944	N/A	INTRINSIC
low complexity region	1024	1038	N/A	INTRINSIC
low complexity region	1081	1095	N/A	INTRINSIC
low complexity region	1166	1175	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000130065
AA Change: S78A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000115989
Gene: ENSMUSG00000021318
AA Change: S78A

Domain	Start	End	E-Value	Type
low complexity region	120	136	N/A	INTRINSIC
low complexity region	204	220	N/A	INTRINSIC
low complexity region	324	341	N/A	INTRINSIC
low complexity region	403	421	N/A	INTRINSIC
ZnF_C2H2	480	505	1.53e-1	SMART
ZnF_C2H2	513	540	1.23e0	SMART
ZnF_C2H2	546	570	3.16e-3	SMART
ZnF_C2H2	576	596	1.45e2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130535

Predicted Effect

probably benign
Transcript: ENSMUST00000141194

Meta Mutation Damage Score

0.1266

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (101/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA986860	A	G	1: 130,741,003	S36G	probably damaging	Het
Aarsd1	T	C	11: 101,410,377	N280D	probably benign	Het
Abca2	T	A	2: 25,445,674	M2099K	probably damaging	Het
Abcb5	T	A	12: 118,911,543	E631D	probably benign	Het
Acss2	T	A	2: 155,573,229	L682Q	probably null	Het
Adamts14	G	A	10: 61,198,488	P1207L	probably benign	Het
Adora1	G	A	1: 134,203,010	R308*	probably null	Het
Arcn1	A	T	9: 44,757,147	V264E	probably benign	Het
B3galt1	G	A	2: 68,118,768	G276S	probably damaging	Het
Bms1	A	T	6: 118,405,218	M453K	possibly damaging	Het
Bnip3l	T	C	14: 66,987,731	Y218C	probably damaging	Het
Cacna2d2	A	G	9: 107,513,606	E379G	probably null	Het
Cacng6	G	A	7: 3,434,860	G235R	probably damaging	Het
Capn8	A	T	1: 182,628,604	T640S	probably benign	Het
Ccdc106	T	C	7: 5,060,160		probably benign	Het
Ccdc33	A	T	9: 58,086,577	N95K	probably benign	Het
Celsr3	T	A	9: 108,842,708		probably benign	Het
Cemip	A	T	7: 83,955,301	N844K	probably damaging	Het
Chrdl2	A	T	7: 100,028,741	T284S	probably damaging	Het
Ckm	A	G	7: 19,420,165	Y279C	probably damaging	Het
Clvs1	A	T	4: 9,424,261	I236F	probably damaging	Het
Col9a1	T	C	1: 24,195,539		probably null	Het
Csmd1	T	C	8: 17,216,712	E66G	possibly damaging	Het
Ctdsp2	A	G	10: 126,996,054	D26G	probably damaging	Het
Ctsll3	C	A	13: 60,798,907		probably null	Het
Cyp2d12	A	T	15: 82,555,222	M26L	probably benign	Het
Cyp8b1	C	T	9: 121,914,884	D461N	probably damaging	Het
Dbt	A	T	3: 116,528,571		probably benign	Het
Dnah7c	A	G	1: 46,665,568	D2247G	probably benign	Het
Dsg1c	A	G	18: 20,267,937	I166V	possibly damaging	Het
Duoxa1	T	A	2: 122,303,880	E252D	probably damaging	Het
Ezr	T	A	17: 6,753,049	K211M	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fahd2a	T	C	2: 127,441,958	D54G	possibly damaging	Het
Fbxo9	A	T	9: 78,095,864		probably null	Het
Fndc1	A	G	17: 7,772,708	S719P	unknown	Het
Gas7	G	T	11: 67,662,090	G159C	probably damaging	Het
Gba2	T	C	4: 43,574,063	D130G	probably damaging	Het
Gtpbp6	A	G	5: 110,106,904	F101S	probably damaging	Het
Gzme	G	A	14: 56,117,767	H236Y	probably benign	Het
Hira	T	C	16: 18,954,758	Y943H	probably damaging	Het
Hmbox1	G	A	14: 64,896,695	S152L	possibly damaging	Het
Ibtk	A	G	9: 85,737,466		probably null	Het
Jade1	T	C	3: 41,613,978	I827T	possibly damaging	Het
Jakmip3	A	T	7: 139,025,435	E389D	possibly damaging	Het
Klhdc8b	A	T	9: 108,449,042		probably benign	Het
Lama2	T	C	10: 27,138,946	T1589A	probably benign	Het
Lbx2	A	C	6: 83,087,803	K107T	probably damaging	Het
Ldha	A	G	7: 46,854,098	M259V	probably benign	Het
Lrrtm4	A	G	6: 80,022,637	K344R	probably damaging	Het
Ltb	A	T	17: 35,195,959	E245V	probably damaging	Het
Macf1	GCCCCC	GCCCCCC	4: 123,350,991		probably null	Het
Map3k13	T	A	16: 21,921,647	S575T	possibly damaging	Het
Mcpt2	A	T	14: 56,043,376	I74F	probably damaging	Het
Mpeg1	T	A	19: 12,461,649	V157D	probably damaging	Het
Mrpl21	A	T	19: 3,287,009		probably null	Het
Nagpa	T	C	16: 5,200,013	T99A	possibly damaging	Het
Nphs1	A	T	7: 30,463,825	I469F	probably benign	Het
Nyap2	A	G	1: 81,192,041	E171G	possibly damaging	Het
Oas1e	A	G	5: 120,791,941	Y171H	probably damaging	Het
Olfr1129	T	A	2: 87,575,699	V205D	probably damaging	Het
Olfr1392	T	C	11: 49,293,666	L115P	probably damaging	Het
Olfr196	T	C	16: 59,167,620	I174M	possibly damaging	Het
Olfr205	T	C	16: 59,329,098	K137R	probably benign	Het
Otud7b	C	A	3: 96,155,738	Q765K	probably benign	Het
Pdzd7	A	G	19: 45,028,777	V851A	probably benign	Het
Pi4ka	T	G	16: 17,325,413	K794T	probably damaging	Het
Pkhd1l1	T	A	15: 44,546,862	N2588K	probably damaging	Het
Pla2g6	A	T	15: 79,302,637	M471K	probably benign	Het
Plagl2	T	C	2: 153,235,839	H74R	possibly damaging	Het
Prf1	T	A	10: 61,300,258	N104K	probably benign	Het
Ptprf	A	T	4: 118,236,389	I358N	probably damaging	Het
Rcsd1	A	G	1: 165,655,303		probably null	Het
Rev1	G	A	1: 38,108,451	R3*	probably null	Het
Rp1	T	C	1: 4,349,360		probably null	Het
Rrp12	G	A	19: 41,892,596	T132I	probably damaging	Het
Sema3a	T	C	5: 13,599,389	V702A	probably benign	Het
Serpinb12	A	G	1: 106,956,444	N307D	probably damaging	Het
Slc35d1	A	G	4: 103,213,186	L103P	probably damaging	Het
Smyd4	T	C	11: 75,390,939	C413R	probably damaging	Het
Stab1	G	A	14: 31,161,836	Q255*	probably null	Het
Synpo	T	A	18: 60,603,846	I343F	possibly damaging	Het
Tcirg1	A	G	19: 3,902,342		probably null	Het
Tmem132c	A	G	5: 127,563,752	T996A	possibly damaging	Het
Trim10	A	G	17: 36,870,189	E104G	probably damaging	Het
Trpc1	T	C	9: 95,721,471		probably null	Het
Tspo2	A	T	17: 48,449,859		probably benign	Het
Ugt2a3	A	T	5: 87,331,315	I258N	probably damaging	Het
Usp34	T	C	11: 23,468,846	L2998P	probably damaging	Het
Vmn1r45	A	C	6: 89,933,141	D162E	possibly damaging	Het
Vmn2r117	A	T	17: 23,477,874	Y186*	probably null	Het
Vmn2r67	A	G	7: 85,136,490	F769S	probably damaging	Het
Zbtb17	A	G	4: 141,465,631	I514V	probably benign	Het
Zfp329	A	C	7: 12,811,494	D34E	probably benign	Het

Other mutations in Gli3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Gli3	APN	13	15644299	missense	probably damaging	1.00
IGL00471:Gli3	APN	13	15723769	critical splice donor site	probably null
IGL00484:Gli3	APN	13	15644392	missense	possibly damaging	0.84
IGL00588:Gli3	APN	13	15644392	missense	possibly damaging	0.84
IGL01161:Gli3	APN	13	15548398	critical splice acceptor site	probably null
IGL01633:Gli3	APN	13	15648634	missense	probably damaging	1.00
IGL01799:Gli3	APN	13	15726161	missense	probably benign	0.00
IGL01861:Gli3	APN	13	15725325	missense	probably damaging	1.00
IGL02063:Gli3	APN	13	15726372	missense	possibly damaging	0.94
IGL02112:Gli3	APN	13	15662514	missense	probably damaging	1.00
IGL02255:Gli3	APN	13	15648719	missense	probably damaging	1.00
IGL02270:Gli3	APN	13	15726786	utr 3 prime	probably benign
IGL02336:Gli3	APN	13	15720289	missense	probably damaging	1.00
IGL02346:Gli3	APN	13	15723693	missense	probably damaging	1.00
IGL02744:Gli3	APN	13	15613886	critical splice donor site	probably null
IGL02877:Gli3	APN	13	15724742	missense	probably damaging	1.00
IGL02975:Gli3	APN	13	15724568	missense	probably damaging	1.00
IGL03018:Gli3	APN	13	15660132	missense	probably damaging	1.00
IGL03378:Gli3	APN	13	15644420	missense	probably damaging	1.00
IGL03406:Gli3	APN	13	15648581	missense	probably damaging	1.00
Capone	UTSW	13	15715034	missense	probably damaging	1.00
Carpals	UTSW	13	15713650	critical splice donor site	probably null
Ness	UTSW	13	15723555	missense	probably damaging	1.00
FR4737:Gli3	UTSW	13	15644357	missense	probably damaging	1.00
R0110:Gli3	UTSW	13	15724785	missense	probably damaging	1.00
R0329:Gli3	UTSW	13	15723558	missense	probably damaging	0.98
R0330:Gli3	UTSW	13	15723558	missense	probably damaging	0.98
R0360:Gli3	UTSW	13	15724764	missense	probably benign	0.32
R0364:Gli3	UTSW	13	15724764	missense	probably benign	0.32
R0469:Gli3	UTSW	13	15724785	missense	probably damaging	1.00
R0616:Gli3	UTSW	13	15662406	missense	possibly damaging	0.75
R0639:Gli3	UTSW	13	15724715	missense	probably damaging	1.00
R1072:Gli3	UTSW	13	15713605	missense	probably damaging	1.00
R1257:Gli3	UTSW	13	15725996	nonsense	probably null
R1270:Gli3	UTSW	13	15723744	missense	probably benign	0.02
R1424:Gli3	UTSW	13	15726314	missense	probably benign	0.00
R1481:Gli3	UTSW	13	15613850	missense	probably damaging	0.99
R1596:Gli3	UTSW	13	15725471	missense	possibly damaging	0.74
R1628:Gli3	UTSW	13	15726312	missense	probably benign	0.00
R1721:Gli3	UTSW	13	15726297	missense	probably benign	0.27
R1797:Gli3	UTSW	13	15713512	missense	probably damaging	0.99
R1813:Gli3	UTSW	13	15648691	missense	probably damaging	1.00
R1819:Gli3	UTSW	13	15725792	nonsense	probably null
R1988:Gli3	UTSW	13	15726380	missense	probably benign
R2132:Gli3	UTSW	13	15725549	missense	possibly damaging	0.74
R2352:Gli3	UTSW	13	15662392	missense	probably benign	0.02
R3085:Gli3	UTSW	13	15660941	missense	probably damaging	1.00
R3177:Gli3	UTSW	13	15725982	missense	probably benign	0.28
R3277:Gli3	UTSW	13	15725982	missense	probably benign	0.28
R4162:Gli3	UTSW	13	15725115	missense	possibly damaging	0.93
R4497:Gli3	UTSW	13	15723571	missense	possibly damaging	0.74
R4526:Gli3	UTSW	13	15713631	missense	probably damaging	1.00
R4979:Gli3	UTSW	13	15724464	missense	possibly damaging	0.87
R5395:Gli3	UTSW	13	15714950	missense	probably damaging	1.00
R5494:Gli3	UTSW	13	15725982	missense	probably benign	0.28
R5609:Gli3	UTSW	13	15548453	missense	possibly damaging	0.82
R5718:Gli3	UTSW	13	15478165	critical splice donor site	probably null
R5810:Gli3	UTSW	13	15644309	missense	probably damaging	0.99
R5896:Gli3	UTSW	13	15726180	missense	probably benign	0.00
R5930:Gli3	UTSW	13	15548625	missense	probably damaging	1.00
R5964:Gli3	UTSW	13	15726162	nonsense	probably null
R5985:Gli3	UTSW	13	15723555	missense	probably damaging	1.00
R6224:Gli3	UTSW	13	15725145	missense	probably benign
R6278:Gli3	UTSW	13	15725113	missense	possibly damaging	0.69
R6330:Gli3	UTSW	13	15724732	missense	probably damaging	1.00
R6383:Gli3	UTSW	13	15723555	missense	probably damaging	1.00
R6523:Gli3	UTSW	13	15713650	critical splice donor site	probably null
R7072:Gli3	UTSW	13	15725695	missense	possibly damaging	0.51
R7085:Gli3	UTSW	13	15715062	missense	probably damaging	1.00
R7228:Gli3	UTSW	13	15724502	missense	probably benign	0.00
R7327:Gli3	UTSW	13	15725559	missense	probably benign	0.02
R7451:Gli3	UTSW	13	15726291	missense	possibly damaging	0.50
R7974:Gli3	UTSW	13	15726256	missense	probably benign	0.00
R8167:Gli3	UTSW	13	15725643	missense	probably benign	0.00
R8170:Gli3	UTSW	13	15720208	missense	probably benign
R8199:Gli3	UTSW	13	15725991	missense	probably benign	0.08
R8247:Gli3	UTSW	13	15726775	missense	possibly damaging	0.82
R8332:Gli3	UTSW	13	15713548	missense	possibly damaging	0.58
R8347:Gli3	UTSW	13	15723525	missense	probably damaging	1.00
R8559:Gli3	UTSW	13	15660132	missense	probably damaging	1.00
R8676:Gli3	UTSW	13	15715034	missense	probably damaging	1.00
R8905:Gli3	UTSW	13	15726531	missense	probably benign	0.01
R9099:Gli3	UTSW	13	15726735	missense	probably damaging	1.00
R9260:Gli3	UTSW	13	15725090	missense	probably damaging	0.99
R9317:Gli3	UTSW	13	15715073	missense	probably damaging	1.00
R9475:Gli3	UTSW	13	15725711	missense	possibly damaging	0.87
R9546:Gli3	UTSW	13	15613858	missense	probably benign	0.00
R9571:Gli3	UTSW	13	15726273	missense	probably benign	0.00
R9621:Gli3	UTSW	13	15726668	missense	probably benign	0.01
R9704:Gli3	UTSW	13	15723473	missense	probably damaging	1.00
R9787:Gli3	UTSW	13	15725801	missense	probably damaging	0.96
RF010:Gli3	UTSW	13	15726369	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGACAAAGGAGGTTTCTTCCC -3'
(R):5'- CCCATGTCTCTCAGAAAATGTG -3'

Sequencing Primer
(F):5'- GAGGTTTCTTCCCTACAGAGAGAAC -3'
(R):5'- GTGCTAATTGGCAGGAAGTACTTAC -3'

Posted On

2016-08-04