Incidental Mutation 'R5327:Gli3'
ID 422072
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene Name GLI-Kruppel family member GLI3
Synonyms Bph, brachyphalangy
MMRRC Submission 042910-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5327 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 15638308-15904611 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 15723092 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 78 (S78A)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510] [ENSMUST00000130065] [ENSMUST00000141194]
AlphaFold Q61602
Predicted Effect probably damaging
Transcript: ENSMUST00000110510
AA Change: S78A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: S78A

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130065
AA Change: S78A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115989
Gene: ENSMUSG00000021318
AA Change: S78A

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 596 1.45e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130535
Predicted Effect probably benign
Transcript: ENSMUST00000141194
Meta Mutation Damage Score 0.1266 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,668,740 (GRCm39) S36G probably damaging Het
Aarsd1 T C 11: 101,301,203 (GRCm39) N280D probably benign Het
Abca2 T A 2: 25,335,686 (GRCm39) M2099K probably damaging Het
Abcb5 T A 12: 118,875,278 (GRCm39) E631D probably benign Het
Acss2 T A 2: 155,415,149 (GRCm39) L682Q probably null Het
Adamts14 G A 10: 61,034,267 (GRCm39) P1207L probably benign Het
Adora1 G A 1: 134,130,748 (GRCm39) R308* probably null Het
Arcn1 A T 9: 44,668,444 (GRCm39) V264E probably benign Het
B3galt1 G A 2: 67,949,112 (GRCm39) G276S probably damaging Het
Bms1 A T 6: 118,382,179 (GRCm39) M453K possibly damaging Het
Bnip3l T C 14: 67,225,180 (GRCm39) Y218C probably damaging Het
Cacna2d2 A G 9: 107,390,805 (GRCm39) E379G probably null Het
Cacng6 G A 7: 3,483,376 (GRCm39) G235R probably damaging Het
Capn8 A T 1: 182,456,169 (GRCm39) T640S probably benign Het
Ccdc106 T C 7: 5,063,159 (GRCm39) probably benign Het
Ccdc33 A T 9: 57,993,860 (GRCm39) N95K probably benign Het
Celsr3 T A 9: 108,719,907 (GRCm39) probably benign Het
Cemip A T 7: 83,604,509 (GRCm39) N844K probably damaging Het
Chrdl2 A T 7: 99,677,948 (GRCm39) T284S probably damaging Het
Ckm A G 7: 19,154,090 (GRCm39) Y279C probably damaging Het
Clvs1 A T 4: 9,424,261 (GRCm39) I236F probably damaging Het
Col9a1 T C 1: 24,234,620 (GRCm39) probably null Het
Csmd1 T C 8: 17,266,728 (GRCm39) E66G possibly damaging Het
Ctdsp2 A G 10: 126,831,923 (GRCm39) D26G probably damaging Het
Ctsll3 C A 13: 60,946,721 (GRCm39) probably null Het
Cyp2d12 A T 15: 82,439,423 (GRCm39) M26L probably benign Het
Cyp8b1 C T 9: 121,743,950 (GRCm39) D461N probably damaging Het
Dbt A T 3: 116,322,220 (GRCm39) probably benign Het
Dnah7c A G 1: 46,704,728 (GRCm39) D2247G probably benign Het
Dsg1c A G 18: 20,400,994 (GRCm39) I166V possibly damaging Het
Duoxa1 T A 2: 122,134,361 (GRCm39) E252D probably damaging Het
Ezr T A 17: 7,020,448 (GRCm39) K211M probably damaging Het
Faap100 T A 11: 120,268,458 (GRCm39) E105V possibly damaging Het
Fahd2a T C 2: 127,283,878 (GRCm39) D54G possibly damaging Het
Fbxo9 A T 9: 78,003,146 (GRCm39) probably null Het
Fndc1 A G 17: 7,991,540 (GRCm39) S719P unknown Het
Gas7 G T 11: 67,552,916 (GRCm39) G159C probably damaging Het
Gba2 T C 4: 43,574,063 (GRCm39) D130G probably damaging Het
Gtpbp6 A G 5: 110,254,770 (GRCm39) F101S probably damaging Het
Gzme G A 14: 56,355,224 (GRCm39) H236Y probably benign Het
Hira T C 16: 18,773,508 (GRCm39) Y943H probably damaging Het
Hmbox1 G A 14: 65,134,144 (GRCm39) S152L possibly damaging Het
Ibtk A G 9: 85,619,519 (GRCm39) probably null Het
Jade1 T C 3: 41,568,413 (GRCm39) I827T possibly damaging Het
Jakmip3 A T 7: 138,627,164 (GRCm39) E389D possibly damaging Het
Klhdc8b A T 9: 108,326,241 (GRCm39) probably benign Het
Lama2 T C 10: 27,014,942 (GRCm39) T1589A probably benign Het
Lbx2 A C 6: 83,064,784 (GRCm39) K107T probably damaging Het
Ldha A G 7: 46,503,522 (GRCm39) M259V probably benign Het
Lrrtm4 A G 6: 79,999,620 (GRCm39) K344R probably damaging Het
Ltb A T 17: 35,414,935 (GRCm39) E245V probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,244,784 (GRCm39) probably null Het
Map3k13 T A 16: 21,740,397 (GRCm39) S575T possibly damaging Het
Mcpt2 A T 14: 56,280,833 (GRCm39) I74F probably damaging Het
Mpeg1 T A 19: 12,439,013 (GRCm39) V157D probably damaging Het
Mrpl21 A T 19: 3,337,009 (GRCm39) probably null Het
Nagpa T C 16: 5,017,877 (GRCm39) T99A possibly damaging Het
Nphs1 A T 7: 30,163,250 (GRCm39) I469F probably benign Het
Nyap2 A G 1: 81,169,756 (GRCm39) E171G possibly damaging Het
Oas1e A G 5: 120,930,006 (GRCm39) Y171H probably damaging Het
Or10ag59 T A 2: 87,406,043 (GRCm39) V205D probably damaging Het
Or2y1f T C 11: 49,184,493 (GRCm39) L115P probably damaging Het
Or5ac23 T C 16: 59,149,461 (GRCm39) K137R probably benign Het
Or5h26 T C 16: 58,987,983 (GRCm39) I174M possibly damaging Het
Otud7b C A 3: 96,063,055 (GRCm39) Q765K probably benign Het
Pdzd7 A G 19: 45,017,216 (GRCm39) V851A probably benign Het
Pi4ka T G 16: 17,143,277 (GRCm39) K794T probably damaging Het
Pkhd1l1 T A 15: 44,410,258 (GRCm39) N2588K probably damaging Het
Pla2g6 A T 15: 79,186,837 (GRCm39) M471K probably benign Het
Plagl2 T C 2: 153,077,759 (GRCm39) H74R possibly damaging Het
Prf1 T A 10: 61,136,037 (GRCm39) N104K probably benign Het
Ptprf A T 4: 118,093,586 (GRCm39) I358N probably damaging Het
Rcsd1 A G 1: 165,482,872 (GRCm39) probably null Het
Rev1 G A 1: 38,147,532 (GRCm39) R3* probably null Het
Rp1 T C 1: 4,419,583 (GRCm39) probably null Het
Rrp12 G A 19: 41,881,035 (GRCm39) T132I probably damaging Het
Sema3a T C 5: 13,649,357 (GRCm39) V702A probably benign Het
Serpinb12 A G 1: 106,884,174 (GRCm39) N307D probably damaging Het
Slc35d1 A G 4: 103,070,383 (GRCm39) L103P probably damaging Het
Smyd4 T C 11: 75,281,765 (GRCm39) C413R probably damaging Het
Stab1 G A 14: 30,883,793 (GRCm39) Q255* probably null Het
Synpo T A 18: 60,736,918 (GRCm39) I343F possibly damaging Het
Tcirg1 A G 19: 3,952,342 (GRCm39) probably null Het
Tmem132c A G 5: 127,640,816 (GRCm39) T996A possibly damaging Het
Trim10 A G 17: 37,181,081 (GRCm39) E104G probably damaging Het
Trpc1 T C 9: 95,603,524 (GRCm39) probably null Het
Tspo2 A T 17: 48,756,887 (GRCm39) probably benign Het
Ugt2a3 A T 5: 87,479,174 (GRCm39) I258N probably damaging Het
Usp34 T C 11: 23,418,846 (GRCm39) L2998P probably damaging Het
Vmn1r45 A C 6: 89,910,123 (GRCm39) D162E possibly damaging Het
Vmn2r117 A T 17: 23,696,848 (GRCm39) Y186* probably null Het
Vmn2r67 A G 7: 84,785,698 (GRCm39) F769S probably damaging Het
Zbtb17 A G 4: 141,192,942 (GRCm39) I514V probably benign Het
Zfp329 A C 7: 12,545,421 (GRCm39) D34E probably benign Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15,818,884 (GRCm39) missense probably damaging 1.00
IGL00471:Gli3 APN 13 15,898,354 (GRCm39) critical splice donor site probably null
IGL00484:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15,722,983 (GRCm39) critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15,823,219 (GRCm39) missense probably damaging 1.00
IGL01799:Gli3 APN 13 15,900,746 (GRCm39) missense probably benign 0.00
IGL01861:Gli3 APN 13 15,899,910 (GRCm39) missense probably damaging 1.00
IGL02063:Gli3 APN 13 15,900,957 (GRCm39) missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15,837,099 (GRCm39) missense probably damaging 1.00
IGL02255:Gli3 APN 13 15,823,304 (GRCm39) missense probably damaging 1.00
IGL02270:Gli3 APN 13 15,901,371 (GRCm39) utr 3 prime probably benign
IGL02336:Gli3 APN 13 15,894,874 (GRCm39) missense probably damaging 1.00
IGL02346:Gli3 APN 13 15,898,278 (GRCm39) missense probably damaging 1.00
IGL02744:Gli3 APN 13 15,788,471 (GRCm39) critical splice donor site probably null
IGL02877:Gli3 APN 13 15,899,327 (GRCm39) missense probably damaging 1.00
IGL02975:Gli3 APN 13 15,899,153 (GRCm39) missense probably damaging 1.00
IGL03018:Gli3 APN 13 15,834,717 (GRCm39) missense probably damaging 1.00
IGL03378:Gli3 APN 13 15,819,005 (GRCm39) missense probably damaging 1.00
IGL03406:Gli3 APN 13 15,823,166 (GRCm39) missense probably damaging 1.00
Capone UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
Carpals UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
Ness UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15,818,942 (GRCm39) missense probably damaging 1.00
R0110:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0329:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0330:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0360:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0364:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0469:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0616:Gli3 UTSW 13 15,836,991 (GRCm39) missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15,899,300 (GRCm39) missense probably damaging 1.00
R1072:Gli3 UTSW 13 15,888,190 (GRCm39) missense probably damaging 1.00
R1257:Gli3 UTSW 13 15,900,581 (GRCm39) nonsense probably null
R1270:Gli3 UTSW 13 15,898,329 (GRCm39) missense probably benign 0.02
R1424:Gli3 UTSW 13 15,900,899 (GRCm39) missense probably benign 0.00
R1481:Gli3 UTSW 13 15,788,435 (GRCm39) missense probably damaging 0.99
R1596:Gli3 UTSW 13 15,900,056 (GRCm39) missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15,900,897 (GRCm39) missense probably benign 0.00
R1721:Gli3 UTSW 13 15,900,882 (GRCm39) missense probably benign 0.27
R1797:Gli3 UTSW 13 15,888,097 (GRCm39) missense probably damaging 0.99
R1813:Gli3 UTSW 13 15,823,276 (GRCm39) missense probably damaging 1.00
R1819:Gli3 UTSW 13 15,900,377 (GRCm39) nonsense probably null
R1988:Gli3 UTSW 13 15,900,965 (GRCm39) missense probably benign
R2132:Gli3 UTSW 13 15,900,134 (GRCm39) missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15,836,977 (GRCm39) missense probably benign 0.02
R3085:Gli3 UTSW 13 15,835,526 (GRCm39) missense probably damaging 1.00
R3177:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R3277:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R4162:Gli3 UTSW 13 15,899,700 (GRCm39) missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15,898,156 (GRCm39) missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15,888,216 (GRCm39) missense probably damaging 1.00
R4979:Gli3 UTSW 13 15,899,049 (GRCm39) missense possibly damaging 0.87
R5395:Gli3 UTSW 13 15,889,535 (GRCm39) missense probably damaging 1.00
R5494:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R5609:Gli3 UTSW 13 15,723,038 (GRCm39) missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15,652,750 (GRCm39) critical splice donor site probably null
R5810:Gli3 UTSW 13 15,818,894 (GRCm39) missense probably damaging 0.99
R5896:Gli3 UTSW 13 15,900,765 (GRCm39) missense probably benign 0.00
R5930:Gli3 UTSW 13 15,723,210 (GRCm39) missense probably damaging 1.00
R5964:Gli3 UTSW 13 15,900,747 (GRCm39) nonsense probably null
R5985:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6224:Gli3 UTSW 13 15,899,730 (GRCm39) missense probably benign
R6278:Gli3 UTSW 13 15,899,698 (GRCm39) missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15,899,317 (GRCm39) missense probably damaging 1.00
R6383:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6523:Gli3 UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
R7072:Gli3 UTSW 13 15,900,280 (GRCm39) missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15,889,647 (GRCm39) missense probably damaging 1.00
R7228:Gli3 UTSW 13 15,899,087 (GRCm39) missense probably benign 0.00
R7327:Gli3 UTSW 13 15,900,144 (GRCm39) missense probably benign 0.02
R7451:Gli3 UTSW 13 15,900,876 (GRCm39) missense possibly damaging 0.50
R7974:Gli3 UTSW 13 15,900,841 (GRCm39) missense probably benign 0.00
R8167:Gli3 UTSW 13 15,900,228 (GRCm39) missense probably benign 0.00
R8170:Gli3 UTSW 13 15,894,793 (GRCm39) missense probably benign
R8199:Gli3 UTSW 13 15,900,576 (GRCm39) missense probably benign 0.08
R8247:Gli3 UTSW 13 15,901,360 (GRCm39) missense possibly damaging 0.82
R8332:Gli3 UTSW 13 15,888,133 (GRCm39) missense possibly damaging 0.58
R8347:Gli3 UTSW 13 15,898,110 (GRCm39) missense probably damaging 1.00
R8559:Gli3 UTSW 13 15,834,717 (GRCm39) missense probably damaging 1.00
R8676:Gli3 UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
R8905:Gli3 UTSW 13 15,901,116 (GRCm39) missense probably benign 0.01
R9099:Gli3 UTSW 13 15,901,320 (GRCm39) missense probably damaging 1.00
R9260:Gli3 UTSW 13 15,899,675 (GRCm39) missense probably damaging 0.99
R9317:Gli3 UTSW 13 15,889,658 (GRCm39) missense probably damaging 1.00
R9475:Gli3 UTSW 13 15,900,296 (GRCm39) missense possibly damaging 0.87
R9546:Gli3 UTSW 13 15,788,443 (GRCm39) missense probably benign 0.00
R9571:Gli3 UTSW 13 15,900,858 (GRCm39) missense probably benign 0.00
R9621:Gli3 UTSW 13 15,901,253 (GRCm39) missense probably benign 0.01
R9704:Gli3 UTSW 13 15,898,058 (GRCm39) missense probably damaging 1.00
R9787:Gli3 UTSW 13 15,900,386 (GRCm39) missense probably damaging 0.96
RF010:Gli3 UTSW 13 15,900,954 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACAAAGGAGGTTTCTTCCC -3'
(R):5'- CCCATGTCTCTCAGAAAATGTG -3'

Sequencing Primer
(F):5'- GAGGTTTCTTCCCTACAGAGAGAAC -3'
(R):5'- GTGCTAATTGGCAGGAAGTACTTAC -3'
Posted On 2016-08-04