Incidental Mutation 'R5327:Map3k13'
ID 422085
Institutional Source Beutler Lab
Gene Symbol Map3k13
Ensembl Gene ENSMUSG00000033618
Gene Name mitogen-activated protein kinase kinase kinase 13
Synonyms C130026N12Rik
MMRRC Submission 042910-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5327 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 21643923-21752189 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21740397 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 575 (S575T)
Ref Sequence ENSEMBL: ENSMUSP00000156202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042065] [ENSMUST00000231988] [ENSMUST00000232240]
AlphaFold Q1HKZ5
Predicted Effect possibly damaging
Transcript: ENSMUST00000042065
AA Change: S575T

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047388
Gene: ENSMUSG00000033618
AA Change: S575T

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
Pfam:Pkinase 167 406 3.1e-60 PFAM
Pfam:Pkinase_Tyr 167 406 2.4e-65 PFAM
coiled coil region 456 502 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
low complexity region 805 821 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000231988
AA Change: S575T

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000232240
AA Change: S575T

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.0899 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,668,740 (GRCm39) S36G probably damaging Het
Aarsd1 T C 11: 101,301,203 (GRCm39) N280D probably benign Het
Abca2 T A 2: 25,335,686 (GRCm39) M2099K probably damaging Het
Abcb5 T A 12: 118,875,278 (GRCm39) E631D probably benign Het
Acss2 T A 2: 155,415,149 (GRCm39) L682Q probably null Het
Adamts14 G A 10: 61,034,267 (GRCm39) P1207L probably benign Het
Adora1 G A 1: 134,130,748 (GRCm39) R308* probably null Het
Arcn1 A T 9: 44,668,444 (GRCm39) V264E probably benign Het
B3galt1 G A 2: 67,949,112 (GRCm39) G276S probably damaging Het
Bms1 A T 6: 118,382,179 (GRCm39) M453K possibly damaging Het
Bnip3l T C 14: 67,225,180 (GRCm39) Y218C probably damaging Het
Cacna2d2 A G 9: 107,390,805 (GRCm39) E379G probably null Het
Cacng6 G A 7: 3,483,376 (GRCm39) G235R probably damaging Het
Capn8 A T 1: 182,456,169 (GRCm39) T640S probably benign Het
Ccdc106 T C 7: 5,063,159 (GRCm39) probably benign Het
Ccdc33 A T 9: 57,993,860 (GRCm39) N95K probably benign Het
Celsr3 T A 9: 108,719,907 (GRCm39) probably benign Het
Cemip A T 7: 83,604,509 (GRCm39) N844K probably damaging Het
Chrdl2 A T 7: 99,677,948 (GRCm39) T284S probably damaging Het
Ckm A G 7: 19,154,090 (GRCm39) Y279C probably damaging Het
Clvs1 A T 4: 9,424,261 (GRCm39) I236F probably damaging Het
Col9a1 T C 1: 24,234,620 (GRCm39) probably null Het
Csmd1 T C 8: 17,266,728 (GRCm39) E66G possibly damaging Het
Ctdsp2 A G 10: 126,831,923 (GRCm39) D26G probably damaging Het
Ctsll3 C A 13: 60,946,721 (GRCm39) probably null Het
Cyp2d12 A T 15: 82,439,423 (GRCm39) M26L probably benign Het
Cyp8b1 C T 9: 121,743,950 (GRCm39) D461N probably damaging Het
Dbt A T 3: 116,322,220 (GRCm39) probably benign Het
Dnah7c A G 1: 46,704,728 (GRCm39) D2247G probably benign Het
Dsg1c A G 18: 20,400,994 (GRCm39) I166V possibly damaging Het
Duoxa1 T A 2: 122,134,361 (GRCm39) E252D probably damaging Het
Ezr T A 17: 7,020,448 (GRCm39) K211M probably damaging Het
Faap100 T A 11: 120,268,458 (GRCm39) E105V possibly damaging Het
Fahd2a T C 2: 127,283,878 (GRCm39) D54G possibly damaging Het
Fbxo9 A T 9: 78,003,146 (GRCm39) probably null Het
Fndc1 A G 17: 7,991,540 (GRCm39) S719P unknown Het
Gas7 G T 11: 67,552,916 (GRCm39) G159C probably damaging Het
Gba2 T C 4: 43,574,063 (GRCm39) D130G probably damaging Het
Gli3 T G 13: 15,723,092 (GRCm39) S78A probably damaging Het
Gtpbp6 A G 5: 110,254,770 (GRCm39) F101S probably damaging Het
Gzme G A 14: 56,355,224 (GRCm39) H236Y probably benign Het
Hira T C 16: 18,773,508 (GRCm39) Y943H probably damaging Het
Hmbox1 G A 14: 65,134,144 (GRCm39) S152L possibly damaging Het
Ibtk A G 9: 85,619,519 (GRCm39) probably null Het
Jade1 T C 3: 41,568,413 (GRCm39) I827T possibly damaging Het
Jakmip3 A T 7: 138,627,164 (GRCm39) E389D possibly damaging Het
Klhdc8b A T 9: 108,326,241 (GRCm39) probably benign Het
Lama2 T C 10: 27,014,942 (GRCm39) T1589A probably benign Het
Lbx2 A C 6: 83,064,784 (GRCm39) K107T probably damaging Het
Ldha A G 7: 46,503,522 (GRCm39) M259V probably benign Het
Lrrtm4 A G 6: 79,999,620 (GRCm39) K344R probably damaging Het
Ltb A T 17: 35,414,935 (GRCm39) E245V probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,244,784 (GRCm39) probably null Het
Mcpt2 A T 14: 56,280,833 (GRCm39) I74F probably damaging Het
Mpeg1 T A 19: 12,439,013 (GRCm39) V157D probably damaging Het
Mrpl21 A T 19: 3,337,009 (GRCm39) probably null Het
Nagpa T C 16: 5,017,877 (GRCm39) T99A possibly damaging Het
Nphs1 A T 7: 30,163,250 (GRCm39) I469F probably benign Het
Nyap2 A G 1: 81,169,756 (GRCm39) E171G possibly damaging Het
Oas1e A G 5: 120,930,006 (GRCm39) Y171H probably damaging Het
Or10ag59 T A 2: 87,406,043 (GRCm39) V205D probably damaging Het
Or2y1f T C 11: 49,184,493 (GRCm39) L115P probably damaging Het
Or5ac23 T C 16: 59,149,461 (GRCm39) K137R probably benign Het
Or5h26 T C 16: 58,987,983 (GRCm39) I174M possibly damaging Het
Otud7b C A 3: 96,063,055 (GRCm39) Q765K probably benign Het
Pdzd7 A G 19: 45,017,216 (GRCm39) V851A probably benign Het
Pi4ka T G 16: 17,143,277 (GRCm39) K794T probably damaging Het
Pkhd1l1 T A 15: 44,410,258 (GRCm39) N2588K probably damaging Het
Pla2g6 A T 15: 79,186,837 (GRCm39) M471K probably benign Het
Plagl2 T C 2: 153,077,759 (GRCm39) H74R possibly damaging Het
Prf1 T A 10: 61,136,037 (GRCm39) N104K probably benign Het
Ptprf A T 4: 118,093,586 (GRCm39) I358N probably damaging Het
Rcsd1 A G 1: 165,482,872 (GRCm39) probably null Het
Rev1 G A 1: 38,147,532 (GRCm39) R3* probably null Het
Rp1 T C 1: 4,419,583 (GRCm39) probably null Het
Rrp12 G A 19: 41,881,035 (GRCm39) T132I probably damaging Het
Sema3a T C 5: 13,649,357 (GRCm39) V702A probably benign Het
Serpinb12 A G 1: 106,884,174 (GRCm39) N307D probably damaging Het
Slc35d1 A G 4: 103,070,383 (GRCm39) L103P probably damaging Het
Smyd4 T C 11: 75,281,765 (GRCm39) C413R probably damaging Het
Stab1 G A 14: 30,883,793 (GRCm39) Q255* probably null Het
Synpo T A 18: 60,736,918 (GRCm39) I343F possibly damaging Het
Tcirg1 A G 19: 3,952,342 (GRCm39) probably null Het
Tmem132c A G 5: 127,640,816 (GRCm39) T996A possibly damaging Het
Trim10 A G 17: 37,181,081 (GRCm39) E104G probably damaging Het
Trpc1 T C 9: 95,603,524 (GRCm39) probably null Het
Tspo2 A T 17: 48,756,887 (GRCm39) probably benign Het
Ugt2a3 A T 5: 87,479,174 (GRCm39) I258N probably damaging Het
Usp34 T C 11: 23,418,846 (GRCm39) L2998P probably damaging Het
Vmn1r45 A C 6: 89,910,123 (GRCm39) D162E possibly damaging Het
Vmn2r117 A T 17: 23,696,848 (GRCm39) Y186* probably null Het
Vmn2r67 A G 7: 84,785,698 (GRCm39) F769S probably damaging Het
Zbtb17 A G 4: 141,192,942 (GRCm39) I514V probably benign Het
Zfp329 A C 7: 12,545,421 (GRCm39) D34E probably benign Het
Other mutations in Map3k13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Map3k13 APN 16 21,740,514 (GRCm39) missense probably benign 0.00
IGL01092:Map3k13 APN 16 21,746,766 (GRCm39) missense probably damaging 0.97
IGL01958:Map3k13 APN 16 21,710,873 (GRCm39) missense probably benign
IGL02444:Map3k13 APN 16 21,732,982 (GRCm39) missense probably benign 0.19
IGL02503:Map3k13 APN 16 21,727,454 (GRCm39) missense possibly damaging 0.50
IGL02712:Map3k13 APN 16 21,724,005 (GRCm39) missense probably damaging 0.99
IGL03342:Map3k13 APN 16 21,710,981 (GRCm39) missense possibly damaging 0.94
R0086:Map3k13 UTSW 16 21,732,975 (GRCm39) missense probably damaging 0.98
R0124:Map3k13 UTSW 16 21,722,506 (GRCm39) missense possibly damaging 0.95
R0281:Map3k13 UTSW 16 21,732,907 (GRCm39) missense probably damaging 1.00
R0308:Map3k13 UTSW 16 21,710,738 (GRCm39) missense probably benign
R0601:Map3k13 UTSW 16 21,723,999 (GRCm39) missense possibly damaging 0.95
R0669:Map3k13 UTSW 16 21,725,274 (GRCm39) missense probably benign 0.03
R0918:Map3k13 UTSW 16 21,744,990 (GRCm39) missense probably damaging 1.00
R1641:Map3k13 UTSW 16 21,722,542 (GRCm39) missense probably damaging 1.00
R1838:Map3k13 UTSW 16 21,732,939 (GRCm39) missense possibly damaging 0.92
R1891:Map3k13 UTSW 16 21,729,836 (GRCm39) missense probably damaging 1.00
R2125:Map3k13 UTSW 16 21,710,894 (GRCm39) missense probably benign 0.01
R2332:Map3k13 UTSW 16 21,717,427 (GRCm39) splice site probably null
R2361:Map3k13 UTSW 16 21,725,286 (GRCm39) missense probably benign 0.05
R4395:Map3k13 UTSW 16 21,717,321 (GRCm39) missense possibly damaging 0.49
R4505:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4506:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4521:Map3k13 UTSW 16 21,724,525 (GRCm39) missense possibly damaging 0.94
R4753:Map3k13 UTSW 16 21,710,752 (GRCm39) missense probably benign
R4952:Map3k13 UTSW 16 21,729,769 (GRCm39) missense probably benign 0.15
R5035:Map3k13 UTSW 16 21,740,421 (GRCm39) missense probably benign 0.03
R5784:Map3k13 UTSW 16 21,717,391 (GRCm39) missense possibly damaging 0.68
R5831:Map3k13 UTSW 16 21,746,798 (GRCm39) makesense probably null
R5996:Map3k13 UTSW 16 21,723,995 (GRCm39) missense possibly damaging 0.95
R6007:Map3k13 UTSW 16 21,723,933 (GRCm39) missense possibly damaging 0.95
R6546:Map3k13 UTSW 16 21,740,527 (GRCm39) missense probably benign 0.15
R6620:Map3k13 UTSW 16 21,711,061 (GRCm39) missense possibly damaging 0.62
R6683:Map3k13 UTSW 16 21,711,062 (GRCm39) missense probably benign 0.32
R6692:Map3k13 UTSW 16 21,723,987 (GRCm39) missense possibly damaging 0.66
R6695:Map3k13 UTSW 16 21,741,028 (GRCm39) missense probably benign 0.10
R6743:Map3k13 UTSW 16 21,711,173 (GRCm39) missense probably damaging 0.98
R6822:Map3k13 UTSW 16 21,741,013 (GRCm39) missense probably benign 0.00
R6965:Map3k13 UTSW 16 21,740,900 (GRCm39) missense probably benign
R7149:Map3k13 UTSW 16 21,744,187 (GRCm39) missense probably benign 0.04
R7174:Map3k13 UTSW 16 21,745,006 (GRCm39) missense probably damaging 1.00
R7256:Map3k13 UTSW 16 21,710,988 (GRCm39) missense probably benign 0.03
R7400:Map3k13 UTSW 16 21,741,072 (GRCm39) missense probably damaging 1.00
R7733:Map3k13 UTSW 16 21,740,436 (GRCm39) missense probably damaging 1.00
R7848:Map3k13 UTSW 16 21,724,621 (GRCm39) missense probably damaging 0.98
R7871:Map3k13 UTSW 16 21,740,346 (GRCm39) missense probably benign 0.09
R7876:Map3k13 UTSW 16 21,741,069 (GRCm39) missense probably benign 0.00
R8002:Map3k13 UTSW 16 21,723,878 (GRCm39) missense probably benign 0.05
R8089:Map3k13 UTSW 16 21,722,567 (GRCm39) missense possibly damaging 0.48
R8341:Map3k13 UTSW 16 21,740,334 (GRCm39) nonsense probably null
R8738:Map3k13 UTSW 16 21,745,008 (GRCm39) missense probably damaging 1.00
R8940:Map3k13 UTSW 16 21,727,454 (GRCm39) missense possibly damaging 0.50
R8949:Map3k13 UTSW 16 21,723,882 (GRCm39) missense probably benign 0.05
R9391:Map3k13 UTSW 16 21,740,665 (GRCm39) missense probably benign 0.00
R9749:Map3k13 UTSW 16 21,740,581 (GRCm39) missense probably benign 0.00
R9802:Map3k13 UTSW 16 21,740,518 (GRCm39) missense possibly damaging 0.85
Z1176:Map3k13 UTSW 16 21,723,912 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGACTGAAAGAGTATATGAAGCC -3'
(R):5'- TGATGGACTGAAGCGCACTG -3'

Sequencing Primer
(F):5'- GGATTTGATCCCCAGCATTGCAAG -3'
(R):5'- TGAAGCGCACTGAGCCTGAG -3'
Posted On 2016-08-04